Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633933_at:

>probe:Drosophila_2:1633933_at:603:163; Interrogation_Position=1591; Antisense; AAATATACTCACTCTTTCATCGAAA
>probe:Drosophila_2:1633933_at:428:115; Interrogation_Position=1616; Antisense; AGCATATCGATCCAGAGTTCTTTGA
>probe:Drosophila_2:1633933_at:648:603; Interrogation_Position=1638; Antisense; TGATCACGTTTTACCCCACTATTTA
>probe:Drosophila_2:1633933_at:167:693; Interrogation_Position=1803; Antisense; TTTGACCATTGCCTGGAATCTGCCA
>probe:Drosophila_2:1633933_at:159:367; Interrogation_Position=1818; Antisense; GAATCTGCCACGTATGTATGTTCTG
>probe:Drosophila_2:1633933_at:448:539; Interrogation_Position=1877; Antisense; GGTATATCACCTACATGCCACAAAC
>probe:Drosophila_2:1633933_at:202:529; Interrogation_Position=1902; Antisense; GGGTATTCCCGATTCTTGGACTGAA
>probe:Drosophila_2:1633933_at:611:403; Interrogation_Position=1920; Antisense; GACTGAACAACTTCCTAAGGTCCTT
>probe:Drosophila_2:1633933_at:370:699; Interrogation_Position=1950; Antisense; TTTATACAATGTTACCTCTCCTCGC
>probe:Drosophila_2:1633933_at:476:207; Interrogation_Position=1982; Antisense; AAGAGGGAGCAGTTCCTTTGTCCAT
>probe:Drosophila_2:1633933_at:251:471; Interrogation_Position=1993; Antisense; GTTCCTTTGTCCATTCAGCATTTGA
>probe:Drosophila_2:1633933_at:687:345; Interrogation_Position=2010; Antisense; GCATTTGAGCTGGATATGGCATCTT
>probe:Drosophila_2:1633933_at:274:67; Interrogation_Position=2025; Antisense; ATGGCATCTTCTGTTCATTGGCGAA
>probe:Drosophila_2:1633933_at:478:323; Interrogation_Position=2045; Antisense; GCGAAAGTATCGCAACACTGGTATT

Paste this into a BLAST search page for me
AAATATACTCACTCTTTCATCGAAAAGCATATCGATCCAGAGTTCTTTGATGATCACGTTTTACCCCACTATTTATTTGACCATTGCCTGGAATCTGCCAGAATCTGCCACGTATGTATGTTCTGGGTATATCACCTACATGCCACAAACGGGTATTCCCGATTCTTGGACTGAAGACTGAACAACTTCCTAAGGTCCTTTTTATACAATGTTACCTCTCCTCGCAAGAGGGAGCAGTTCCTTTGTCCATGTTCCTTTGTCCATTCAGCATTTGAGCATTTGAGCTGGATATGGCATCTTATGGCATCTTCTGTTCATTGGCGAAGCGAAAGTATCGCAACACTGGTATT

Full Affymetrix probeset data:

Annotations for 1633933_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime