FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633934_at:

>probe:Drosophila_2:1633934_at:701:333; Interrogation_Position=1009; Antisense; GCTGCTGGAATCTGTGATCTTCGAA
>probe:Drosophila_2:1633934_at:187:225; Interrogation_Position=1052; Antisense; AAGGAGTTCATTCCGTACCGCATAG
>probe:Drosophila_2:1633934_at:720:77; Interrogation_Position=1083; Antisense; AGGTCCAGGTCTATATTCCGCCAGT
>probe:Drosophila_2:1633934_at:295:301; Interrogation_Position=1101; Antisense; CGCCAGTATCCGACTTTGCAGTGAT
>probe:Drosophila_2:1633934_at:357:243; Interrogation_Position=1133; Antisense; AATATCGAACACTCGCTGGAGTCGT
>probe:Drosophila_2:1633934_at:458:427; Interrogation_Position=1166; Antisense; GAGATACAAGCATTCGGCTCCATAT
>probe:Drosophila_2:1633934_at:9:223; Interrogation_Position=1202; Antisense; AAGGGATCCCGCATTCTTAAATTGA
>probe:Drosophila_2:1633934_at:297:223; Interrogation_Position=1244; Antisense; AAGGAGATCTTGGTAACCCGCGGCA
>probe:Drosophila_2:1633934_at:264:115; Interrogation_Position=1268; Antisense; AGCATTGTGTACATTCCCGTCGAGG
>probe:Drosophila_2:1633934_at:223:5; Interrogation_Position=1326; Antisense; ATTGCGACGAGGACTTCAGCGGCTA
>probe:Drosophila_2:1633934_at:482:109; Interrogation_Position=1361; Antisense; AGCAACTACTTTCGAGTGCCCTAAA
>probe:Drosophila_2:1633934_at:659:381; Interrogation_Position=904; Antisense; GAACGAGATTCATGCCTACCTGGAC
>probe:Drosophila_2:1633934_at:294:433; Interrogation_Position=941; Antisense; GAGTGCATGGCTTGCTCGGACAATG
>probe:Drosophila_2:1633934_at:104:503; Interrogation_Position=976; Antisense; GGGCCTAACGCCCAAGTACAAGGAT

Paste this into a BLAST search page for me
GCTGCTGGAATCTGTGATCTTCGAAAAGGAGTTCATTCCGTACCGCATAGAGGTCCAGGTCTATATTCCGCCAGTCGCCAGTATCCGACTTTGCAGTGATAATATCGAACACTCGCTGGAGTCGTGAGATACAAGCATTCGGCTCCATATAAGGGATCCCGCATTCTTAAATTGAAAGGAGATCTTGGTAACCCGCGGCAAGCATTGTGTACATTCCCGTCGAGGATTGCGACGAGGACTTCAGCGGCTAAGCAACTACTTTCGAGTGCCCTAAAGAACGAGATTCATGCCTACCTGGACGAGTGCATGGCTTGCTCGGACAATGGGGCCTAACGCCCAAGTACAAGGAT

Full Affymetrix probeset data:

Annotations for 1633934_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720