Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633935_at:

>probe:Drosophila_2:1633935_at:622:125; Interrogation_Position=2064; Antisense; ACCGGTATGGGCACCATCCATGTGG
>probe:Drosophila_2:1633935_at:715:529; Interrogation_Position=2087; Antisense; GGGTGCAGTAGATCGGTTGCCAAAT
>probe:Drosophila_2:1633935_at:682:595; Interrogation_Position=2111; Antisense; TGTGGACAAGCATTTCATGCAGTTT
>probe:Drosophila_2:1633935_at:582:269; Interrogation_Position=2126; Antisense; CATGCAGTTTGTTGATGAACACCAA
>probe:Drosophila_2:1633935_at:225:315; Interrogation_Position=2160; Antisense; GCCATACGAATTTAGCAATCTGCTA
>probe:Drosophila_2:1633935_at:344:551; Interrogation_Position=2192; Antisense; GGAGAAGAGACACTATTTACCCGTA
>probe:Drosophila_2:1633935_at:8:667; Interrogation_Position=2205; Antisense; TATTTACCCGTAGGCGGTCCTGCTG
>probe:Drosophila_2:1633935_at:638:315; Interrogation_Position=2244; Antisense; GCCTTAGTCCTTTTCACGACATGTA
>probe:Drosophila_2:1633935_at:532:135; Interrogation_Position=2259; Antisense; ACGACATGTACCTTTTTGCGTAACA
>probe:Drosophila_2:1633935_at:497:559; Interrogation_Position=2329; Antisense; GGAAATTTGAACTCAACCAGCATCT
>probe:Drosophila_2:1633935_at:294:339; Interrogation_Position=2485; Antisense; GCTAATCGTATTGTATCTCAGTTGT
>probe:Drosophila_2:1633935_at:23:483; Interrogation_Position=2508; Antisense; GTATATACACTCACTAACTGAAGCA
>probe:Drosophila_2:1633935_at:394:161; Interrogation_Position=2541; Antisense; ACAATGTGAAGTTCTGTGTGACGAC
>probe:Drosophila_2:1633935_at:447:517; Interrogation_Position=2556; Antisense; GTGTGACGACATGTCTCATTTCGAA

Paste this into a BLAST search page for me
ACCGGTATGGGCACCATCCATGTGGGGGTGCAGTAGATCGGTTGCCAAATTGTGGACAAGCATTTCATGCAGTTTCATGCAGTTTGTTGATGAACACCAAGCCATACGAATTTAGCAATCTGCTAGGAGAAGAGACACTATTTACCCGTATATTTACCCGTAGGCGGTCCTGCTGGCCTTAGTCCTTTTCACGACATGTAACGACATGTACCTTTTTGCGTAACAGGAAATTTGAACTCAACCAGCATCTGCTAATCGTATTGTATCTCAGTTGTGTATATACACTCACTAACTGAAGCAACAATGTGAAGTTCTGTGTGACGACGTGTGACGACATGTCTCATTTCGAA

Full Affymetrix probeset data:

Annotations for 1633935_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime