Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633939_at:

>probe:Drosophila_2:1633939_at:402:169; Interrogation_Position=1278; Antisense; AAAGGTTCCGGTGCAGATTTCGAGA
>probe:Drosophila_2:1633939_at:503:713; Interrogation_Position=1305; Antisense; TTCTACAGATTCCAGCAAAGCCATG
>probe:Drosophila_2:1633939_at:518:105; Interrogation_Position=1357; Antisense; AGAATTTACCAACGGCGCAAGCACT
>probe:Drosophila_2:1633939_at:177:209; Interrogation_Position=1375; Antisense; AAGCACTTGAACTCCACTGCAATGC
>probe:Drosophila_2:1633939_at:373:357; Interrogation_Position=1471; Antisense; GCAACACCCCGGAAATCGACGAAGG
>probe:Drosophila_2:1633939_at:607:475; Interrogation_Position=1507; Antisense; GTTATCGTTCGAAACGCTACGCAGG
>probe:Drosophila_2:1633939_at:300:335; Interrogation_Position=1522; Antisense; GCTACGCAGGCGATAAGTCACACTT
>probe:Drosophila_2:1633939_at:316:495; Interrogation_Position=1538; Antisense; GTCACACTTTGGCAAAATCTCGCGC
>probe:Drosophila_2:1633939_at:231:39; Interrogation_Position=1554; Antisense; ATCTCGCGCCGATGGTATATCAGAA
>probe:Drosophila_2:1633939_at:465:187; Interrogation_Position=1583; Antisense; AACACGCTTTGGTCACAGAATCGGC
>probe:Drosophila_2:1633939_at:341:57; Interrogation_Position=1639; Antisense; ATGAGGCAGCCCCATATTAAGGCAA
>probe:Drosophila_2:1633939_at:447:77; Interrogation_Position=1663; Antisense; AGGTCAAAGCCGCAAAGGTCCAGAA
>probe:Drosophila_2:1633939_at:516:453; Interrogation_Position=1708; Antisense; GATAATTTCATACCGTCGTTGCCCA
>probe:Drosophila_2:1633939_at:482:291; Interrogation_Position=1721; Antisense; CGTCGTTGCCCATTGAGGTTTATTT

Paste this into a BLAST search page for me
AAAGGTTCCGGTGCAGATTTCGAGATTCTACAGATTCCAGCAAAGCCATGAGAATTTACCAACGGCGCAAGCACTAAGCACTTGAACTCCACTGCAATGCGCAACACCCCGGAAATCGACGAAGGGTTATCGTTCGAAACGCTACGCAGGGCTACGCAGGCGATAAGTCACACTTGTCACACTTTGGCAAAATCTCGCGCATCTCGCGCCGATGGTATATCAGAAAACACGCTTTGGTCACAGAATCGGCATGAGGCAGCCCCATATTAAGGCAAAGGTCAAAGCCGCAAAGGTCCAGAAGATAATTTCATACCGTCGTTGCCCACGTCGTTGCCCATTGAGGTTTATTT

Full Affymetrix probeset data:

Annotations for 1633939_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime