FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633940_at:

>probe:Drosophila_2:1633940_at:177:623; Interrogation_Position=1042; Antisense; TGCGGCATGGCGTGGGATTTACAAC
>probe:Drosophila_2:1633940_at:165:459; Interrogation_Position=1057; Antisense; GATTTACAACCAGCTAACGACACGC
>probe:Drosophila_2:1633940_at:221:339; Interrogation_Position=1080; Antisense; GCTCTTCGACGGACTACGATGGCAT
>probe:Drosophila_2:1633940_at:40:435; Interrogation_Position=1130; Antisense; GAGGGCCTAGACTAATCGCATCTCT
>probe:Drosophila_2:1633940_at:449:635; Interrogation_Position=1145; Antisense; TCGCATCTCTGCAACGATATCTATG
>probe:Drosophila_2:1633940_at:303:149; Interrogation_Position=1265; Antisense; ACTTGGCCATAAATCTTTGGACCGA
>probe:Drosophila_2:1633940_at:154:19; Interrogation_Position=1292; Antisense; ATTTCGTCAGGTAATGATCCCCTCG
>probe:Drosophila_2:1633940_at:482:655; Interrogation_Position=1303; Antisense; TAATGATCCCCTCGTCGTAGATAAC
>probe:Drosophila_2:1633940_at:457:135; Interrogation_Position=1326; Antisense; ACGCTTCGTTCCAAGGATTTGCCAA
>probe:Drosophila_2:1633940_at:443:265; Interrogation_Position=1465; Antisense; CAGAGCCCTGTTGTCATGGAAAAGA
>probe:Drosophila_2:1633940_at:480:29; Interrogation_Position=904; Antisense; ATACAGTTCCGTCAAGCTCACAAAG
>probe:Drosophila_2:1633940_at:624:171; Interrogation_Position=925; Antisense; AAAGACACCCAGTGGCACGGAGGCC
>probe:Drosophila_2:1633940_at:153:89; Interrogation_Position=950; Antisense; AGTCTGACGGCCTCGGAGCGCAAGT
>probe:Drosophila_2:1633940_at:354:361; Interrogation_Position=969; Antisense; GCAAGTTCCTAGACTCCGAGCTGAA

Paste this into a BLAST search page for me
TGCGGCATGGCGTGGGATTTACAACGATTTACAACCAGCTAACGACACGCGCTCTTCGACGGACTACGATGGCATGAGGGCCTAGACTAATCGCATCTCTTCGCATCTCTGCAACGATATCTATGACTTGGCCATAAATCTTTGGACCGAATTTCGTCAGGTAATGATCCCCTCGTAATGATCCCCTCGTCGTAGATAACACGCTTCGTTCCAAGGATTTGCCAACAGAGCCCTGTTGTCATGGAAAAGAATACAGTTCCGTCAAGCTCACAAAGAAAGACACCCAGTGGCACGGAGGCCAGTCTGACGGCCTCGGAGCGCAAGTGCAAGTTCCTAGACTCCGAGCTGAA

Full Affymetrix probeset data:

Annotations for 1633940_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720