FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633943_at:

>probe:Drosophila_2:1633943_at:506:253; Interrogation_Position=110; Antisense; CAACGTATTATACTCTTCCCCATTA
>probe:Drosophila_2:1633943_at:583:365; Interrogation_Position=17; Antisense; GAATAAGCCCACAATGCTGGCCAAT
>probe:Drosophila_2:1633943_at:180:139; Interrogation_Position=182; Antisense; ACGATTCTCGAGTTTTCTTCATTAC
>probe:Drosophila_2:1633943_at:635:377; Interrogation_Position=215; Antisense; GAAGCCGGCTAAACAATCTCGATTG
>probe:Drosophila_2:1633943_at:577:149; Interrogation_Position=280; Antisense; ACATCAGTCTACGATTACCACACGG
>probe:Drosophila_2:1633943_at:454:139; Interrogation_Position=301; Antisense; ACGGGCTTCGAGTGCGTGTACAAAA
>probe:Drosophila_2:1633943_at:69:631; Interrogation_Position=329; Antisense; TCCATTTCTTGGAGAGACTGCTTAA
>probe:Drosophila_2:1633943_at:486:561; Interrogation_Position=386; Antisense; GGAACAGCACGAATCCCGAGTTGAT
>probe:Drosophila_2:1633943_at:420:719; Interrogation_Position=406; Antisense; TTGATGGTTCTACACTTCCCGGAAA
>probe:Drosophila_2:1633943_at:481:371; Interrogation_Position=432; Antisense; GAAGGCACCAACCTACCACATGGTA
>probe:Drosophila_2:1633943_at:421:671; Interrogation_Position=471; Antisense; TACGCGGTGCTTGAACTGGGTTATC
>probe:Drosophila_2:1633943_at:57:213; Interrogation_Position=49; Antisense; AAGACATTCGTGTTTTTGTGCCGGG
>probe:Drosophila_2:1633943_at:371:685; Interrogation_Position=492; Antisense; TATCTGCCTGCTGGGACTGGTTATA
>probe:Drosophila_2:1633943_at:148:477; Interrogation_Position=511; Antisense; GTTATACTTCTCTGCTGCCTGAAAT

Paste this into a BLAST search page for me
CAACGTATTATACTCTTCCCCATTAGAATAAGCCCACAATGCTGGCCAATACGATTCTCGAGTTTTCTTCATTACGAAGCCGGCTAAACAATCTCGATTGACATCAGTCTACGATTACCACACGGACGGGCTTCGAGTGCGTGTACAAAATCCATTTCTTGGAGAGACTGCTTAAGGAACAGCACGAATCCCGAGTTGATTTGATGGTTCTACACTTCCCGGAAAGAAGGCACCAACCTACCACATGGTATACGCGGTGCTTGAACTGGGTTATCAAGACATTCGTGTTTTTGTGCCGGGTATCTGCCTGCTGGGACTGGTTATAGTTATACTTCTCTGCTGCCTGAAAT

Full Affymetrix probeset data:

Annotations for 1633943_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720