FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633944_at:

>probe:Drosophila_2:1633944_at:211:227; Interrogation_Position=1049; Antisense; AAGGCAGCAGCTAAACGTCGCAATG
>probe:Drosophila_2:1633944_at:19:321; Interrogation_Position=1073; Antisense; GCCGCCGCTGCCAAGAAAAGTAATA
>probe:Drosophila_2:1633944_at:303:659; Interrogation_Position=1111; Antisense; TAAGAAGCGAACACCTGTTGCCGCC
>probe:Drosophila_2:1633944_at:233:553; Interrogation_Position=1154; Antisense; GGACCCAACAAACGTAGGCGCTCTG
>probe:Drosophila_2:1633944_at:614:435; Interrogation_Position=673; Antisense; GAGGATTGAGCTTTCTTCGTTTAGA
>probe:Drosophila_2:1633944_at:407:613; Interrogation_Position=723; Antisense; TGAAACTTCTTCTGGTTCTGGCATT
>probe:Drosophila_2:1633944_at:465:521; Interrogation_Position=767; Antisense; GTGGCTGTGGCCCAGACAACTGATT
>probe:Drosophila_2:1633944_at:657:549; Interrogation_Position=803; Antisense; GGAGATTACTCTTACGATTACGCTG
>probe:Drosophila_2:1633944_at:431:55; Interrogation_Position=828; Antisense; ATGACAACGATACTGCCGGTAGCTC
>probe:Drosophila_2:1633944_at:637:397; Interrogation_Position=857; Antisense; GACAACACTGCTGATTCTGGAGACA
>probe:Drosophila_2:1633944_at:515:511; Interrogation_Position=885; Antisense; GTGATAGCTCCACTGACGTCGACAG
>probe:Drosophila_2:1633944_at:532:525; Interrogation_Position=924; Antisense; GGGACGTCGATTCCTATGACGACTA
>probe:Drosophila_2:1633944_at:136:611; Interrogation_Position=940; Antisense; TGACGACTACGAGGGCTCTAGCGAT
>probe:Drosophila_2:1633944_at:237:603; Interrogation_Position=964; Antisense; TGTTACGGAAGCACCAACTGCTGCT

Paste this into a BLAST search page for me
AAGGCAGCAGCTAAACGTCGCAATGGCCGCCGCTGCCAAGAAAAGTAATATAAGAAGCGAACACCTGTTGCCGCCGGACCCAACAAACGTAGGCGCTCTGGAGGATTGAGCTTTCTTCGTTTAGATGAAACTTCTTCTGGTTCTGGCATTGTGGCTGTGGCCCAGACAACTGATTGGAGATTACTCTTACGATTACGCTGATGACAACGATACTGCCGGTAGCTCGACAACACTGCTGATTCTGGAGACAGTGATAGCTCCACTGACGTCGACAGGGGACGTCGATTCCTATGACGACTATGACGACTACGAGGGCTCTAGCGATTGTTACGGAAGCACCAACTGCTGCT

Full Affymetrix probeset data:

Annotations for 1633944_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720