FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633946_at:

>probe:Drosophila_2:1633946_at:435:271; Interrogation_Position=117; Antisense; CATAGTTCTGATCTACCATACGAAT
>probe:Drosophila_2:1633946_at:433:181; Interrogation_Position=157; Antisense; AAAAACACGTTTCGCACATGCCGGA
>probe:Drosophila_2:1633946_at:719:19; Interrogation_Position=202; Antisense; ATATTTTGGATTCAGCTTACGCTTC
>probe:Drosophila_2:1633946_at:384:115; Interrogation_Position=215; Antisense; AGCTTACGCTTCTGCTGAAGGCAAA
>probe:Drosophila_2:1633946_at:467:145; Interrogation_Position=246; Antisense; ACTAGGAAACTTTCGCGCAGCATTC
>probe:Drosophila_2:1633946_at:512:665; Interrogation_Position=372; Antisense; TACAATATACTCCACCAGCGGTTGG
>probe:Drosophila_2:1633946_at:656:543; Interrogation_Position=395; Antisense; GGATATTGCCGAGCCAATCGCAGCA
>probe:Drosophila_2:1633946_at:246:97; Interrogation_Position=439; Antisense; AGATACATCCGTGTCTGCACAAGAT
>probe:Drosophila_2:1633946_at:429:557; Interrogation_Position=468; Antisense; GGACTTCTAGATCCGGAAACCTGCA
>probe:Drosophila_2:1633946_at:67:393; Interrogation_Position=483; Antisense; GAAACCTGCATCAAGTGTCCGCGGT
>probe:Drosophila_2:1633946_at:539:515; Interrogation_Position=497; Antisense; GTGTCCGCGGTGTCATAAGTCCATT
>probe:Drosophila_2:1633946_at:602:657; Interrogation_Position=512; Antisense; TAAGTCCATTTCGTCCACCAAAGTT
>probe:Drosophila_2:1633946_at:321:85; Interrogation_Position=553; Antisense; AGTGACGAATGCAAGCCACCTTCAA
>probe:Drosophila_2:1633946_at:173:689; Interrogation_Position=76; Antisense; TTTTTATCGAACACACCATGGAGGG

Paste this into a BLAST search page for me
CATAGTTCTGATCTACCATACGAATAAAAACACGTTTCGCACATGCCGGAATATTTTGGATTCAGCTTACGCTTCAGCTTACGCTTCTGCTGAAGGCAAAACTAGGAAACTTTCGCGCAGCATTCTACAATATACTCCACCAGCGGTTGGGGATATTGCCGAGCCAATCGCAGCAAGATACATCCGTGTCTGCACAAGATGGACTTCTAGATCCGGAAACCTGCAGAAACCTGCATCAAGTGTCCGCGGTGTGTCCGCGGTGTCATAAGTCCATTTAAGTCCATTTCGTCCACCAAAGTTAGTGACGAATGCAAGCCACCTTCAATTTTTATCGAACACACCATGGAGGG

Full Affymetrix probeset data:

Annotations for 1633946_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720