Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633947_at:

>probe:Drosophila_2:1633947_at:232:193; Interrogation_Position=1146; Antisense; AACTCTACGCCATTATACCATTGTA
>probe:Drosophila_2:1633947_at:711:229; Interrogation_Position=1174; Antisense; AATGTGGATCGAGTGGCCGCCAAAC
>probe:Drosophila_2:1633947_at:35:527; Interrogation_Position=1212; Antisense; GGGCAATCCCAAATTTGTCATCGAG
>probe:Drosophila_2:1633947_at:121:43; Interrogation_Position=1231; Antisense; ATCGAGGCTGGACAGTCGGTCATTA
>probe:Drosophila_2:1633947_at:583:537; Interrogation_Position=1248; Antisense; GGTCATTATTCCATCATCGGCCATA
>probe:Drosophila_2:1633947_at:479:649; Interrogation_Position=1275; Antisense; TCACGATCCCAGTATTTATCCCGAA
>probe:Drosophila_2:1633947_at:333:381; Interrogation_Position=1297; Antisense; GAACCCAATGAGTTTCGACCGGAGA
>probe:Drosophila_2:1633947_at:247:541; Interrogation_Position=1322; Antisense; GGTTTTCTCCAGAAGAATCCGCCAA
>probe:Drosophila_2:1633947_at:353:337; Interrogation_Position=1423; Antisense; GCTCGTATTGGACTAGCCATGCTCA
>probe:Drosophila_2:1633947_at:456:13; Interrogation_Position=1447; Antisense; ATTAAGAACTTCACATTCTCCCCAT
>probe:Drosophila_2:1633947_at:698:135; Interrogation_Position=1569; Antisense; ACGACAAACTTTCCTCACATACATT
>probe:Drosophila_2:1633947_at:595:653; Interrogation_Position=1620; Antisense; TAATCCCAACAGCTGGCTCATTATT
>probe:Drosophila_2:1633947_at:626:689; Interrogation_Position=1644; Antisense; TATTAGGTTCTCCTTGGCCAATTCC
>probe:Drosophila_2:1633947_at:418:487; Interrogation_Position=1709; Antisense; GTACCATAATGAAGCGACCCGTTTG

Paste this into a BLAST search page for me
AACTCTACGCCATTATACCATTGTAAATGTGGATCGAGTGGCCGCCAAACGGGCAATCCCAAATTTGTCATCGAGATCGAGGCTGGACAGTCGGTCATTAGGTCATTATTCCATCATCGGCCATATCACGATCCCAGTATTTATCCCGAAGAACCCAATGAGTTTCGACCGGAGAGGTTTTCTCCAGAAGAATCCGCCAAGCTCGTATTGGACTAGCCATGCTCAATTAAGAACTTCACATTCTCCCCATACGACAAACTTTCCTCACATACATTTAATCCCAACAGCTGGCTCATTATTTATTAGGTTCTCCTTGGCCAATTCCGTACCATAATGAAGCGACCCGTTTG

Full Affymetrix probeset data:

Annotations for 1633947_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime