FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633949_at:

>probe:Drosophila_2:1633949_at:397:31; Interrogation_Position=101; Antisense; ATAAGAAGGAGTACAGCCCGCTGAA
>probe:Drosophila_2:1633949_at:359:331; Interrogation_Position=120; Antisense; GCTGAAACCGATTTTTGTACCGCCG
>probe:Drosophila_2:1633949_at:159:663; Interrogation_Position=150; Antisense; TAAAAAGCACGCCTGGTTTCGCAAC
>probe:Drosophila_2:1633949_at:532:695; Interrogation_Position=166; Antisense; TTTCGCAACTGGTCCACCATACTGA
>probe:Drosophila_2:1633949_at:726:261; Interrogation_Position=180; Antisense; CACCATACTGATGGTCAGCTTCCTG
>probe:Drosophila_2:1633949_at:199:523; Interrogation_Position=209; Antisense; GGGTGTTTATTCTGGGAACCGTGAT
>probe:Drosophila_2:1633949_at:373:381; Interrogation_Position=224; Antisense; GAACCGTGATGCTGGTGGTCCAAGT
>probe:Drosophila_2:1633949_at:121:533; Interrogation_Position=237; Antisense; GGTGGTCCAAGTTTTCACCGCCAGT
>probe:Drosophila_2:1633949_at:20:89; Interrogation_Position=259; Antisense; AGTCCCCTGCAGATCTTCATGATCG
>probe:Drosophila_2:1633949_at:494:385; Interrogation_Position=27; Antisense; GACTAAGGCTGGAACCTCGGGTCCG
>probe:Drosophila_2:1633949_at:695:605; Interrogation_Position=278; Antisense; TGATCGTGGCTATATATGTGGCTAT
>probe:Drosophila_2:1633949_at:173:581; Interrogation_Position=296; Antisense; TGGCTATAGCCGCTGTGATGATTTG
>probe:Drosophila_2:1633949_at:636:553; Interrogation_Position=53; Antisense; GGACGTACCACGATGAGGTTGACTT
>probe:Drosophila_2:1633949_at:470:699; Interrogation_Position=76; Antisense; TTTACCAGCGGATACGAGACTCAGT

Paste this into a BLAST search page for me
ATAAGAAGGAGTACAGCCCGCTGAAGCTGAAACCGATTTTTGTACCGCCGTAAAAAGCACGCCTGGTTTCGCAACTTTCGCAACTGGTCCACCATACTGACACCATACTGATGGTCAGCTTCCTGGGGTGTTTATTCTGGGAACCGTGATGAACCGTGATGCTGGTGGTCCAAGTGGTGGTCCAAGTTTTCACCGCCAGTAGTCCCCTGCAGATCTTCATGATCGGACTAAGGCTGGAACCTCGGGTCCGTGATCGTGGCTATATATGTGGCTATTGGCTATAGCCGCTGTGATGATTTGGGACGTACCACGATGAGGTTGACTTTTTACCAGCGGATACGAGACTCAGT

Full Affymetrix probeset data:

Annotations for 1633949_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720