FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633951_at:

>probe:Drosophila_2:1633951_at:411:95; Interrogation_Position=3293; Antisense; AGATACCGCAGGACTTCTACGACTT
>probe:Drosophila_2:1633951_at:557:95; Interrogation_Position=3368; Antisense; AGATTGAGCACACGTACTACCGCAA
>probe:Drosophila_2:1633951_at:672:605; Interrogation_Position=3450; Antisense; TGAGAGCTTTTTGGACTTGAGTCGC
>probe:Drosophila_2:1633951_at:302:213; Interrogation_Position=3478; Antisense; AAGATGCGCGATGCCGTTCAGGGAT
>probe:Drosophila_2:1633951_at:182:651; Interrogation_Position=3572; Antisense; TCACGCGCATGCATTGAGGTCCTTC
>probe:Drosophila_2:1633951_at:77:433; Interrogation_Position=3587; Antisense; GAGGTCCTTCGGTAGTTTGTATATA
>probe:Drosophila_2:1633951_at:728:421; Interrogation_Position=3619; Antisense; GAGAAGGAACTGTCTCACCGCGGAC
>probe:Drosophila_2:1633951_at:55:261; Interrogation_Position=3634; Antisense; CACCGCGGACTATCTGATTGTACAT
>probe:Drosophila_2:1633951_at:574:481; Interrogation_Position=3675; Antisense; GTATCCCGCTTAACCACGTAAATAT
>probe:Drosophila_2:1633951_at:703:145; Interrogation_Position=3702; Antisense; ACTCAAATCAATCCCCGTGCTAGAT
>probe:Drosophila_2:1633951_at:287:341; Interrogation_Position=3720; Antisense; GCTAGATGCTGCTACGACTGTCGGA
>probe:Drosophila_2:1633951_at:277:175; Interrogation_Position=3746; Antisense; AACAAGACGTTTCTCGAGTTCCTCG
>probe:Drosophila_2:1633951_at:403:177; Interrogation_Position=3802; Antisense; AAACTGTTTTAGGTGCGCCTCATGC
>probe:Drosophila_2:1633951_at:105:217; Interrogation_Position=3836; Antisense; AAGTTGCGCCAGTCACGCATTGATT

Paste this into a BLAST search page for me
AGATACCGCAGGACTTCTACGACTTAGATTGAGCACACGTACTACCGCAATGAGAGCTTTTTGGACTTGAGTCGCAAGATGCGCGATGCCGTTCAGGGATTCACGCGCATGCATTGAGGTCCTTCGAGGTCCTTCGGTAGTTTGTATATAGAGAAGGAACTGTCTCACCGCGGACCACCGCGGACTATCTGATTGTACATGTATCCCGCTTAACCACGTAAATATACTCAAATCAATCCCCGTGCTAGATGCTAGATGCTGCTACGACTGTCGGAAACAAGACGTTTCTCGAGTTCCTCGAAACTGTTTTAGGTGCGCCTCATGCAAGTTGCGCCAGTCACGCATTGATT

Full Affymetrix probeset data:

Annotations for 1633951_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720