FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633952_at:

>probe:Drosophila_2:1633952_at:138:211; Interrogation_Position=1009; Antisense; AAGAATCGACGCACTTTCGAGCGCA
>probe:Drosophila_2:1633952_at:204:361; Interrogation_Position=1031; Antisense; GCAAGGAGCAGGTCCTCTCCAGATA
>probe:Drosophila_2:1633952_at:404:455; Interrogation_Position=1052; Antisense; GATACCCCTACAACTAAATGTCCTC
>probe:Drosophila_2:1633952_at:154:169; Interrogation_Position=1067; Antisense; AAATGTCCTCTCTAATCTTACTCAC
>probe:Drosophila_2:1633952_at:533:153; Interrogation_Position=642; Antisense; ACATGGATCAGGTGTGGCGCCCAAT
>probe:Drosophila_2:1633952_at:572:219; Interrogation_Position=668; Antisense; AAGTGCAGGCTCAGCTTTTGCAAGC
>probe:Drosophila_2:1633952_at:546:589; Interrogation_Position=722; Antisense; TGGGTAACCAGGTGGCTCAGTCGCA
>probe:Drosophila_2:1633952_at:215:103; Interrogation_Position=746; Antisense; AGAGCTCCTCTTTGGATGCCTATGA
>probe:Drosophila_2:1633952_at:91:57; Interrogation_Position=767; Antisense; ATGACTACAAGCAGAGCACTCCCGG
>probe:Drosophila_2:1633952_at:116:91; Interrogation_Position=803; Antisense; AGTACCAAAGGTTCGTCACCAGCTG
>probe:Drosophila_2:1633952_at:414:55; Interrogation_Position=878; Antisense; ATGAGAGCCACCAGCGGGTTCTGCA
>probe:Drosophila_2:1633952_at:489:539; Interrogation_Position=894; Antisense; GGTTCTGCAGACAGTGCGAGCCAGT
>probe:Drosophila_2:1633952_at:510:125; Interrogation_Position=912; Antisense; AGCCAGTACCCAACCTCGAGTGGAG
>probe:Drosophila_2:1633952_at:333:127; Interrogation_Position=949; Antisense; AGCCAGGTGATCTATGTGCCAGCGG

Paste this into a BLAST search page for me
AAGAATCGACGCACTTTCGAGCGCAGCAAGGAGCAGGTCCTCTCCAGATAGATACCCCTACAACTAAATGTCCTCAAATGTCCTCTCTAATCTTACTCACACATGGATCAGGTGTGGCGCCCAATAAGTGCAGGCTCAGCTTTTGCAAGCTGGGTAACCAGGTGGCTCAGTCGCAAGAGCTCCTCTTTGGATGCCTATGAATGACTACAAGCAGAGCACTCCCGGAGTACCAAAGGTTCGTCACCAGCTGATGAGAGCCACCAGCGGGTTCTGCAGGTTCTGCAGACAGTGCGAGCCAGTAGCCAGTACCCAACCTCGAGTGGAGAGCCAGGTGATCTATGTGCCAGCGG

Full Affymetrix probeset data:

Annotations for 1633952_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720