Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633953_at:

>probe:Drosophila_2:1633953_at:496:365; Interrogation_Position=1005; Antisense; GAATCCTTTCGTGGTCATTACCCTG
>probe:Drosophila_2:1633953_at:348:111; Interrogation_Position=1058; Antisense; AGAATTCCATGGTGACGCTCTGGCT
>probe:Drosophila_2:1633953_at:443:583; Interrogation_Position=1078; Antisense; TGGCTCGCCGTCACAGAACTGGAAG
>probe:Drosophila_2:1633953_at:679:517; Interrogation_Position=1117; Antisense; GTGGGCATCGTATTCAATCTGTCCG
>probe:Drosophila_2:1633953_at:360:249; Interrogation_Position=1131; Antisense; CAATCTGTCCGAGAGCTTCATGGCG
>probe:Drosophila_2:1633953_at:546:67; Interrogation_Position=1150; Antisense; ATGGCGGTCACCTTTGAGGCTGTCT
>probe:Drosophila_2:1633953_at:334:313; Interrogation_Position=1180; Antisense; GCCACTCCGGACATTATAGCCAATT
>probe:Drosophila_2:1633953_at:576:679; Interrogation_Position=1253; Antisense; TAGGAGGTCCAGTTTTTGCGATTTT
>probe:Drosophila_2:1633953_at:136:419; Interrogation_Position=1287; Antisense; GAGCTTGGCCTTTATATTCAATCAC
>probe:Drosophila_2:1633953_at:138:601; Interrogation_Position=1343; Antisense; TGTACGGCGATCTGGGCGACAACTG
>probe:Drosophila_2:1633953_at:66:161; Interrogation_Position=1361; Antisense; ACAACTGCTACCTCTTTCTGGTAAT
>probe:Drosophila_2:1633953_at:564:97; Interrogation_Position=1438; Antisense; AGATCCGCTGGAGTTTTCCTGTGGC
>probe:Drosophila_2:1633953_at:419:723; Interrogation_Position=1471; Antisense; TTGCAGTTCCTCTTATATGCGGTCT
>probe:Drosophila_2:1633953_at:178:549; Interrogation_Position=971; Antisense; GGAGTAAGCTGCTCAACTGCACGCA

Paste this into a BLAST search page for me
GAATCCTTTCGTGGTCATTACCCTGAGAATTCCATGGTGACGCTCTGGCTTGGCTCGCCGTCACAGAACTGGAAGGTGGGCATCGTATTCAATCTGTCCGCAATCTGTCCGAGAGCTTCATGGCGATGGCGGTCACCTTTGAGGCTGTCTGCCACTCCGGACATTATAGCCAATTTAGGAGGTCCAGTTTTTGCGATTTTGAGCTTGGCCTTTATATTCAATCACTGTACGGCGATCTGGGCGACAACTGACAACTGCTACCTCTTTCTGGTAATAGATCCGCTGGAGTTTTCCTGTGGCTTGCAGTTCCTCTTATATGCGGTCTGGAGTAAGCTGCTCAACTGCACGCA

Full Affymetrix probeset data:

Annotations for 1633953_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime