FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633954_at:

>probe:Drosophila_2:1633954_at:103:383; Interrogation_Position=533; Antisense; GAACGCATCGTTAAACTTTGTCAGT
>probe:Drosophila_2:1633954_at:323:179; Interrogation_Position=545; Antisense; AAACTTTGTCAGTTGCTGCTGCAAG
>probe:Drosophila_2:1633954_at:312:495; Interrogation_Position=552; Antisense; GTCAGTTGCTGCTGCAAGATTTCGC
>probe:Drosophila_2:1633954_at:507:621; Interrogation_Position=558; Antisense; TGCTGCTGCAAGATTTCGCAACACG
>probe:Drosophila_2:1633954_at:235:361; Interrogation_Position=565; Antisense; GCAAGATTTCGCAACACGCACAGAG
>probe:Drosophila_2:1633954_at:204:95; Interrogation_Position=568; Antisense; AGATTTCGCAACACGCACAGAGGTT
>probe:Drosophila_2:1633954_at:538:187; Interrogation_Position=577; Antisense; AACACGCACAGAGGTTGTCCAGCTG
>probe:Drosophila_2:1633954_at:83:137; Interrogation_Position=580; Antisense; ACGCACAGAGGTTGTCCAGCTGCAA
>probe:Drosophila_2:1633954_at:81:357; Interrogation_Position=582; Antisense; GCACAGAGGTTGTCCAGCTGCAAAA
>probe:Drosophila_2:1633954_at:106:437; Interrogation_Position=587; Antisense; GAGGTTGTCCAGCTGCAAAAGGCTT
>probe:Drosophila_2:1633954_at:224:463; Interrogation_Position=590; Antisense; GTTGTCCAGCTGCAAAAGGCTTCCC
>probe:Drosophila_2:1633954_at:356:331; Interrogation_Position=598; Antisense; GCTGCAAAAGGCTTCCCCAAACGTT
>probe:Drosophila_2:1633954_at:642:719; Interrogation_Position=610; Antisense; TTCCCCAAACGTTCCGACAGCTGAG
>probe:Drosophila_2:1633954_at:203:177; Interrogation_Position=616; Antisense; AAACGTTCCGACAGCTGAGCAGCAA

Paste this into a BLAST search page for me
GAACGCATCGTTAAACTTTGTCAGTAAACTTTGTCAGTTGCTGCTGCAAGGTCAGTTGCTGCTGCAAGATTTCGCTGCTGCTGCAAGATTTCGCAACACGGCAAGATTTCGCAACACGCACAGAGAGATTTCGCAACACGCACAGAGGTTAACACGCACAGAGGTTGTCCAGCTGACGCACAGAGGTTGTCCAGCTGCAAGCACAGAGGTTGTCCAGCTGCAAAAGAGGTTGTCCAGCTGCAAAAGGCTTGTTGTCCAGCTGCAAAAGGCTTCCCGCTGCAAAAGGCTTCCCCAAACGTTTTCCCCAAACGTTCCGACAGCTGAGAAACGTTCCGACAGCTGAGCAGCAA

Full Affymetrix probeset data:

Annotations for 1633954_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720