FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633955_at:

>probe:Drosophila_2:1633955_at:609:519; Interrogation_Position=1015; Antisense; GTGGACTTTAAAATCCCAGCCAAAT
>probe:Drosophila_2:1633955_at:204:211; Interrogation_Position=1055; Antisense; AAGAAGATTTCTGTTCGCTGGCCAT
>probe:Drosophila_2:1633955_at:519:469; Interrogation_Position=1067; Antisense; GTTCGCTGGCCATTCAATCTATAAA
>probe:Drosophila_2:1633955_at:512:33; Interrogation_Position=1157; Antisense; ATCAAAGGCTGGGATTCGCACCGGT
>probe:Drosophila_2:1633955_at:687:9; Interrogation_Position=1170; Antisense; ATTCGCACCGGTAAACTCAGCAGTT
>probe:Drosophila_2:1633955_at:38:173; Interrogation_Position=1204; Antisense; AAAGCGGTTCTGTGGCGGATCTTCA
>probe:Drosophila_2:1633955_at:543:545; Interrogation_Position=1220; Antisense; GGATCTTCACTTTATTGCTGGCTTG
>probe:Drosophila_2:1633955_at:598:471; Interrogation_Position=670; Antisense; GTTCAAAGCCCAGTGTTTTCATTTT
>probe:Drosophila_2:1633955_at:122:613; Interrogation_Position=732; Antisense; TGAACTTATTTTGGGCGGCTCGGAT
>probe:Drosophila_2:1633955_at:35:597; Interrogation_Position=786; Antisense; TGTGAATGTCGTTCAGGCCGCATAT
>probe:Drosophila_2:1633955_at:221:499; Interrogation_Position=838; Antisense; GTCGGTAGTACTTCCATTAGCACCT
>probe:Drosophila_2:1633955_at:686:385; Interrogation_Position=887; Antisense; GAACATCTCTGATTATAGCTCCCCA
>probe:Drosophila_2:1633955_at:63:283; Interrogation_Position=905; Antisense; CTCCCCAGGCGCAATATGATCAGAT
>probe:Drosophila_2:1633955_at:187:403; Interrogation_Position=959; Antisense; GACTTTTCGAATGCAGTTCCACTTC

Paste this into a BLAST search page for me
GTGGACTTTAAAATCCCAGCCAAATAAGAAGATTTCTGTTCGCTGGCCATGTTCGCTGGCCATTCAATCTATAAAATCAAAGGCTGGGATTCGCACCGGTATTCGCACCGGTAAACTCAGCAGTTAAAGCGGTTCTGTGGCGGATCTTCAGGATCTTCACTTTATTGCTGGCTTGGTTCAAAGCCCAGTGTTTTCATTTTTGAACTTATTTTGGGCGGCTCGGATTGTGAATGTCGTTCAGGCCGCATATGTCGGTAGTACTTCCATTAGCACCTGAACATCTCTGATTATAGCTCCCCACTCCCCAGGCGCAATATGATCAGATGACTTTTCGAATGCAGTTCCACTTC

Full Affymetrix probeset data:

Annotations for 1633955_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720