FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633958_at:

>probe:Drosophila_2:1633958_at:309:451; Interrogation_Position=1008; Antisense; GATCGCACTGGAAACGAACCGACAT
>probe:Drosophila_2:1633958_at:248:615; Interrogation_Position=1040; Antisense; TGCAACTTTCCATCTTACAATCTTC
>probe:Drosophila_2:1633958_at:18:481; Interrogation_Position=1066; Antisense; GTTTGCACAATATTCCCACAGTGAG
>probe:Drosophila_2:1633958_at:232:453; Interrogation_Position=638; Antisense; GATCTAGATCCCGAAACCATGTCAA
>probe:Drosophila_2:1633958_at:664:49; Interrogation_Position=687; Antisense; ATGCTAATGGCGCTACTGTGAAATC
>probe:Drosophila_2:1633958_at:540:481; Interrogation_Position=714; Antisense; GTATCGATACCATATTGCCGACTAT
>probe:Drosophila_2:1633958_at:184:319; Interrogation_Position=730; Antisense; GCCGACTATGCACATTGATGACTTT
>probe:Drosophila_2:1633958_at:568:55; Interrogation_Position=747; Antisense; ATGACTTTTTGTTCGATCCTTGCGG
>probe:Drosophila_2:1633958_at:514:47; Interrogation_Position=762; Antisense; ATCCTTGCGGCTACTCCATGAATGG
>probe:Drosophila_2:1633958_at:247:55; Interrogation_Position=809; Antisense; ATGACAATTCATATTACTCCGGAGA
>probe:Drosophila_2:1633958_at:435:489; Interrogation_Position=902; Antisense; GTAATCAATACTTTCAAGCCGGGAA
>probe:Drosophila_2:1633958_at:170:491; Interrogation_Position=935; Antisense; GTAACCATCTTTGCCAATAAGTGCT
>probe:Drosophila_2:1633958_at:520:31; Interrogation_Position=951; Antisense; ATAAGTGCTCGTTGGCCTACGAAAC
>probe:Drosophila_2:1633958_at:29:521; Interrogation_Position=992; Antisense; GTGGAGTACTCACAGGGATCGCACT

Paste this into a BLAST search page for me
GATCGCACTGGAAACGAACCGACATTGCAACTTTCCATCTTACAATCTTCGTTTGCACAATATTCCCACAGTGAGGATCTAGATCCCGAAACCATGTCAAATGCTAATGGCGCTACTGTGAAATCGTATCGATACCATATTGCCGACTATGCCGACTATGCACATTGATGACTTTATGACTTTTTGTTCGATCCTTGCGGATCCTTGCGGCTACTCCATGAATGGATGACAATTCATATTACTCCGGAGAGTAATCAATACTTTCAAGCCGGGAAGTAACCATCTTTGCCAATAAGTGCTATAAGTGCTCGTTGGCCTACGAAACGTGGAGTACTCACAGGGATCGCACT

Full Affymetrix probeset data:

Annotations for 1633958_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720