FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633960_at:

>probe:Drosophila_2:1633960_at:559:365; Interrogation_Position=1332; Antisense; GAATAGTGCACGGAACTCCTATCTA
>probe:Drosophila_2:1633960_at:535:145; Interrogation_Position=1346; Antisense; ACTCCTATCTAAACTGGCAGTCCGT
>probe:Drosophila_2:1633960_at:266:349; Interrogation_Position=1362; Antisense; GCAGTCCGTCTATTCAAACCTGGTG
>probe:Drosophila_2:1633960_at:224:203; Interrogation_Position=1378; Antisense; AACCTGGTGATCATTATCTGCTTTG
>probe:Drosophila_2:1633960_at:26:41; Interrogation_Position=1393; Antisense; ATCTGCTTTGCAATTTTTGCCCTCA
>probe:Drosophila_2:1633960_at:334:701; Interrogation_Position=1407; Antisense; TTTTGCCCTCATTGTTAATTACGTG
>probe:Drosophila_2:1633960_at:678:13; Interrogation_Position=1457; Antisense; ATTACCGACACAGCCTCTATATTTA
>probe:Drosophila_2:1633960_at:233:475; Interrogation_Position=1494; Antisense; GTTACACATCCGTATGCGTGTGCAT
>probe:Drosophila_2:1633960_at:658:51; Interrogation_Position=1507; Antisense; ATGCGTGTGCATATCTAATCTAGTT
>probe:Drosophila_2:1633960_at:712:497; Interrogation_Position=1544; Antisense; GTCTTCGTGGATTGTATACCGCTTG
>probe:Drosophila_2:1633960_at:608:707; Interrogation_Position=1577; Antisense; TTACATACCCCGCTTGATTCAAAAA
>probe:Drosophila_2:1633960_at:228:463; Interrogation_Position=1635; Antisense; GATTCCCACGATTGCTGACTTAGTC
>probe:Drosophila_2:1633960_at:188:709; Interrogation_Position=1758; Antisense; TTAACGCCTAGTTTAATGCAACGTG
>probe:Drosophila_2:1633960_at:511:321; Interrogation_Position=1820; Antisense; GCCCGGCAACATATGAGCTCGTGTA

Paste this into a BLAST search page for me
GAATAGTGCACGGAACTCCTATCTAACTCCTATCTAAACTGGCAGTCCGTGCAGTCCGTCTATTCAAACCTGGTGAACCTGGTGATCATTATCTGCTTTGATCTGCTTTGCAATTTTTGCCCTCATTTTGCCCTCATTGTTAATTACGTGATTACCGACACAGCCTCTATATTTAGTTACACATCCGTATGCGTGTGCATATGCGTGTGCATATCTAATCTAGTTGTCTTCGTGGATTGTATACCGCTTGTTACATACCCCGCTTGATTCAAAAAGATTCCCACGATTGCTGACTTAGTCTTAACGCCTAGTTTAATGCAACGTGGCCCGGCAACATATGAGCTCGTGTA

Full Affymetrix probeset data:

Annotations for 1633960_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720