Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633961_s_at:

>probe:Drosophila_2:1633961_s_at:599:241; Interrogation_Position=255; Antisense; AATACCTTCTGCACATCTTTCTGAA
>probe:Drosophila_2:1633961_s_at:603:719; Interrogation_Position=281; Antisense; TTGCTCTTCTTGTTCTGCGGCGAAT
>probe:Drosophila_2:1633961_s_at:98:371; Interrogation_Position=302; Antisense; GAATGGTTTTCGCTATGCATCAACA
>probe:Drosophila_2:1633961_s_at:77:29; Interrogation_Position=326; Antisense; ATACCCCTCATAGCCTATCATATTT
>probe:Drosophila_2:1633961_s_at:643:327; Interrogation_Position=352; Antisense; GCGTTACAAAAACCGCCCTGTGATG
>probe:Drosophila_2:1633961_s_at:264:405; Interrogation_Position=375; Antisense; TGTCGGGACCCGGACTTTATGATCC
>probe:Drosophila_2:1633961_s_at:68:669; Interrogation_Position=421; Antisense; TACTTTGTACCGGAACATGCGTGAG
>probe:Drosophila_2:1633961_s_at:612:177; Interrogation_Position=455; Antisense; AAACTGGCCGTCTATCTGATTAGCT
>probe:Drosophila_2:1633961_s_at:377:343; Interrogation_Position=477; Antisense; GCTTCTTCTACTACATATACGGCAT
>probe:Drosophila_2:1633961_s_at:631:669; Interrogation_Position=494; Antisense; TACGGCATGGTTTATTCGCTCATCT
>probe:Drosophila_2:1633961_s_at:370:647; Interrogation_Position=513; Antisense; TCATCTCGACATAGGCAAGCTCTTG
>probe:Drosophila_2:1633961_s_at:464:529; Interrogation_Position=542; Antisense; GGGATCTCAGTGTTGGCGCCAACGC
>probe:Drosophila_2:1633961_s_at:147:271; Interrogation_Position=566; Antisense; CATCAGCGTCGTGTATTAGTTGTCT
>probe:Drosophila_2:1633961_s_at:193:721; Interrogation_Position=769; Antisense; TTGCATATCGCATCTTTGGTGTAGT

Paste this into a BLAST search page for me
AATACCTTCTGCACATCTTTCTGAATTGCTCTTCTTGTTCTGCGGCGAATGAATGGTTTTCGCTATGCATCAACAATACCCCTCATAGCCTATCATATTTGCGTTACAAAAACCGCCCTGTGATGTGTCGGGACCCGGACTTTATGATCCTACTTTGTACCGGAACATGCGTGAGAAACTGGCCGTCTATCTGATTAGCTGCTTCTTCTACTACATATACGGCATTACGGCATGGTTTATTCGCTCATCTTCATCTCGACATAGGCAAGCTCTTGGGGATCTCAGTGTTGGCGCCAACGCCATCAGCGTCGTGTATTAGTTGTCTTTGCATATCGCATCTTTGGTGTAGT

Full Affymetrix probeset data:

Annotations for 1633961_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime