FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633964_at:

>probe:Drosophila_2:1633964_at:390:609; Interrogation_Position=3295; Antisense; TGAGACAACTTTAACCACATCTGTT
>probe:Drosophila_2:1633964_at:668:647; Interrogation_Position=3332; Antisense; TCAAATCGTGTTCGTTTAAGCATCG
>probe:Drosophila_2:1633964_at:209:709; Interrogation_Position=3347; Antisense; TTAAGCATCGAAGCCTAAGTACCAA
>probe:Drosophila_2:1633964_at:421:379; Interrogation_Position=3356; Antisense; GAAGCCTAAGTACCAAAATGCCAGA
>probe:Drosophila_2:1633964_at:176:167; Interrogation_Position=3371; Antisense; AAATGCCAGAAGATTTCGGGTGATT
>probe:Drosophila_2:1633964_at:302:695; Interrogation_Position=3384; Antisense; TTTCGGGTGATTTTGATTGTTTGTC
>probe:Drosophila_2:1633964_at:114:85; Interrogation_Position=3412; Antisense; AGTGGTGTCAATTAAACGTGTATGT
>probe:Drosophila_2:1633964_at:84:491; Interrogation_Position=3435; Antisense; GTACAATAAGCTCCACATGCGATGT
>probe:Drosophila_2:1633964_at:667:21; Interrogation_Position=3483; Antisense; ATATAAGAATCTTCCGTGATATTGG
>probe:Drosophila_2:1633964_at:378:3; Interrogation_Position=3512; Antisense; ATTGAGGTTTTTGCACATTGTTAAA
>probe:Drosophila_2:1633964_at:496:223; Interrogation_Position=3550; Antisense; AAGGTTACACATTTTGCTCATGAAG
>probe:Drosophila_2:1633964_at:300:705; Interrogation_Position=3677; Antisense; TTACTAACCCAGACGATTGACTTTG
>probe:Drosophila_2:1633964_at:237:705; Interrogation_Position=3706; Antisense; TTATGGTGTGCTACTGTGTGAATCA
>probe:Drosophila_2:1633964_at:215:517; Interrogation_Position=3721; Antisense; GTGTGAATCACACCTCATATTATAA

Paste this into a BLAST search page for me
TGAGACAACTTTAACCACATCTGTTTCAAATCGTGTTCGTTTAAGCATCGTTAAGCATCGAAGCCTAAGTACCAAGAAGCCTAAGTACCAAAATGCCAGAAAATGCCAGAAGATTTCGGGTGATTTTTCGGGTGATTTTGATTGTTTGTCAGTGGTGTCAATTAAACGTGTATGTGTACAATAAGCTCCACATGCGATGTATATAAGAATCTTCCGTGATATTGGATTGAGGTTTTTGCACATTGTTAAAAAGGTTACACATTTTGCTCATGAAGTTACTAACCCAGACGATTGACTTTGTTATGGTGTGCTACTGTGTGAATCAGTGTGAATCACACCTCATATTATAA

Full Affymetrix probeset data:

Annotations for 1633964_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720