Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633965_at:

>probe:Drosophila_2:1633965_at:503:109; Interrogation_Position=1028; Antisense; AGAAGACCGTCAAGCAGCCCGTCTA
>probe:Drosophila_2:1633965_at:356:345; Interrogation_Position=1112; Antisense; GCATCTACCAGGCTGTGGGACCTAA
>probe:Drosophila_2:1633965_at:390:511; Interrogation_Position=1126; Antisense; GTGGGACCTAAACGCTATCAGTTGA
>probe:Drosophila_2:1633965_at:636:609; Interrogation_Position=1148; Antisense; TGAGCGAGCTGGTCGACTGGTTCCA
>probe:Drosophila_2:1633965_at:125:153; Interrogation_Position=1208; Antisense; ACATGCGCTACGACATGCGCTGGGA
>probe:Drosophila_2:1633965_at:555:129; Interrogation_Position=1237; Antisense; ACCTTCCTGCTGAAAGCCAAGCTGA
>probe:Drosophila_2:1633965_at:128:439; Interrogation_Position=1321; Antisense; GAGGCTGTCACCGACAAGGTTCTGA
>probe:Drosophila_2:1633965_at:504:397; Interrogation_Position=1333; Antisense; GACAAGGTTCTGACTGGTGTCCCCA
>probe:Drosophila_2:1633965_at:540:295; Interrogation_Position=1358; Antisense; CGCTTGAGGATTTGGGCGTCACGCT
>probe:Drosophila_2:1633965_at:404:329; Interrogation_Position=1373; Antisense; GCGTCACGCTGACCACAATGGAGCA
>probe:Drosophila_2:1633965_at:142:81; Interrogation_Position=1400; Antisense; AGGTGCCATGGGAGCTGCGTCCCTA
>probe:Drosophila_2:1633965_at:54:669; Interrogation_Position=1438; Antisense; TACTACGACGCCGAGCTGGGCGAGT
>probe:Drosophila_2:1633965_at:407:55; Interrogation_Position=1502; Antisense; ATGAACTGCGTCTGTTTGCCTAAGC
>probe:Drosophila_2:1633965_at:233:121; Interrogation_Position=1529; Antisense; AGCGAAGTAGCTGTCTGTGTTGATT

Paste this into a BLAST search page for me
AGAAGACCGTCAAGCAGCCCGTCTAGCATCTACCAGGCTGTGGGACCTAAGTGGGACCTAAACGCTATCAGTTGATGAGCGAGCTGGTCGACTGGTTCCAACATGCGCTACGACATGCGCTGGGAACCTTCCTGCTGAAAGCCAAGCTGAGAGGCTGTCACCGACAAGGTTCTGAGACAAGGTTCTGACTGGTGTCCCCACGCTTGAGGATTTGGGCGTCACGCTGCGTCACGCTGACCACAATGGAGCAAGGTGCCATGGGAGCTGCGTCCCTATACTACGACGCCGAGCTGGGCGAGTATGAACTGCGTCTGTTTGCCTAAGCAGCGAAGTAGCTGTCTGTGTTGATT

Full Affymetrix probeset data:

Annotations for 1633965_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime