FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633966_at:

>probe:Drosophila_2:1633966_at:223:199; Interrogation_Position=413; Antisense; AACGAGCAGCCGTTCTGCAAGGAAA
>probe:Drosophila_2:1633966_at:618:303; Interrogation_Position=445; Antisense; CCGCTTCGATGCGATGTACTACCAT
>probe:Drosophila_2:1633966_at:327:211; Interrogation_Position=536; Antisense; AAGAAGGTTTGCTGCCTGGACGCCA
>probe:Drosophila_2:1633966_at:334:381; Interrogation_Position=563; Antisense; GAACCTCCTGAGATTCTGTACCGGA
>probe:Drosophila_2:1633966_at:308:625; Interrogation_Position=599; Antisense; TGCCCAGGAACTTGCCAAATCAACT
>probe:Drosophila_2:1633966_at:341:31; Interrogation_Position=624; Antisense; ATAAGGCTCGAAGGCTACTCTGTGC
>probe:Drosophila_2:1633966_at:216:395; Interrogation_Position=688; Antisense; GAAATTCTTTCACCCCTGTTGCAAG
>probe:Drosophila_2:1633966_at:5:235; Interrogation_Position=725; Antisense; AATCCTCGTTGCTCCAGAGGCAGAA
>probe:Drosophila_2:1633966_at:125:107; Interrogation_Position=746; Antisense; AGAAAGCCTACCCTATGCACCAAGT
>probe:Drosophila_2:1633966_at:490:53; Interrogation_Position=760; Antisense; ATGCACCAAGTTGCGAGCTCCATAT
>probe:Drosophila_2:1633966_at:534:117; Interrogation_Position=775; Antisense; AGCTCCATATCCTTGTTACTCAGAA
>probe:Drosophila_2:1633966_at:347:425; Interrogation_Position=831; Antisense; GAGAGTGCCTTTGCTTGGAGACCAC
>probe:Drosophila_2:1633966_at:719:259; Interrogation_Position=853; Antisense; CACCCCGAAATGTATAGCTCTTGCG
>probe:Drosophila_2:1633966_at:384:361; Interrogation_Position=936; Antisense; GCAAGTTGAGGGTCTGGCTTTTAAA

Paste this into a BLAST search page for me
AACGAGCAGCCGTTCTGCAAGGAAACCGCTTCGATGCGATGTACTACCATAAGAAGGTTTGCTGCCTGGACGCCAGAACCTCCTGAGATTCTGTACCGGATGCCCAGGAACTTGCCAAATCAACTATAAGGCTCGAAGGCTACTCTGTGCGAAATTCTTTCACCCCTGTTGCAAGAATCCTCGTTGCTCCAGAGGCAGAAAGAAAGCCTACCCTATGCACCAAGTATGCACCAAGTTGCGAGCTCCATATAGCTCCATATCCTTGTTACTCAGAAGAGAGTGCCTTTGCTTGGAGACCACCACCCCGAAATGTATAGCTCTTGCGGCAAGTTGAGGGTCTGGCTTTTAAA

Full Affymetrix probeset data:

Annotations for 1633966_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720