FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633967_at:

>probe:Drosophila_2:1633967_at:425:61; Interrogation_Position=1019; Antisense; ATGTCATCTTCCTGGAGGCGGTCAA
>probe:Drosophila_2:1633967_at:114:505; Interrogation_Position=1059; Antisense; GTGCCGGGCGCTAATTGACGAAATT
>probe:Drosophila_2:1633967_at:469:257; Interrogation_Position=568; Antisense; CACAAAGTGTACTCGGGTCATCTGA
>probe:Drosophila_2:1633967_at:616:537; Interrogation_Position=583; Antisense; GGTCATCTGAAGTGGCTGCCCAAAG
>probe:Drosophila_2:1633967_at:384:27; Interrogation_Position=661; Antisense; ATACTGATTGCCCAATTGCGTCCGG
>probe:Drosophila_2:1633967_at:516:495; Interrogation_Position=686; Antisense; GTCACGAGTTGGATCTGCGCCTGGT
>probe:Drosophila_2:1633967_at:651:555; Interrogation_Position=721; Antisense; GGACTTGGACGGGATCACGCGAAAT
>probe:Drosophila_2:1633967_at:72:407; Interrogation_Position=773; Antisense; GACTGCTGCCCATGATTAAGCTGAA
>probe:Drosophila_2:1633967_at:415:665; Interrogation_Position=830; Antisense; TACAGAACTGTTTCTCACCAGGAGT
>probe:Drosophila_2:1633967_at:273:341; Interrogation_Position=899; Antisense; GCTACGACACGTGCAGCCGAAATGT
>probe:Drosophila_2:1633967_at:455:167; Interrogation_Position=918; Antisense; AAATGTGTATCGCTATCCCCAGCTA
>probe:Drosophila_2:1633967_at:342:307; Interrogation_Position=939; Antisense; GCTAAACGACGCTGTGACTTTGGCC
>probe:Drosophila_2:1633967_at:688:611; Interrogation_Position=953; Antisense; TGACTTTGGCCCGTATCCGAGATCA
>probe:Drosophila_2:1633967_at:675:95; Interrogation_Position=972; Antisense; AGATCACTACATTTTCTCCGTGGAA

Paste this into a BLAST search page for me
ATGTCATCTTCCTGGAGGCGGTCAAGTGCCGGGCGCTAATTGACGAAATTCACAAAGTGTACTCGGGTCATCTGAGGTCATCTGAAGTGGCTGCCCAAAGATACTGATTGCCCAATTGCGTCCGGGTCACGAGTTGGATCTGCGCCTGGTGGACTTGGACGGGATCACGCGAAATGACTGCTGCCCATGATTAAGCTGAATACAGAACTGTTTCTCACCAGGAGTGCTACGACACGTGCAGCCGAAATGTAAATGTGTATCGCTATCCCCAGCTAGCTAAACGACGCTGTGACTTTGGCCTGACTTTGGCCCGTATCCGAGATCAAGATCACTACATTTTCTCCGTGGAA

Full Affymetrix probeset data:

Annotations for 1633967_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720