FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633968_at:

>probe:Drosophila_2:1633968_at:409:499; Interrogation_Position=1635; Antisense; GTCTCTGTTCTCGAATTCATTGCAA
>probe:Drosophila_2:1633968_at:106:361; Interrogation_Position=1656; Antisense; GCAAGTATTACCACATTCCGTATTT
>probe:Drosophila_2:1633968_at:118:393; Interrogation_Position=1754; Antisense; GAAACCACAATCTGCAGTTGCCGTT
>probe:Drosophila_2:1633968_at:528:349; Interrogation_Position=1767; Antisense; GCAGTTGCCGTTCTAGTCACATAAG
>probe:Drosophila_2:1633968_at:588:585; Interrogation_Position=1815; Antisense; TGGAAAGTATTATTCGCCACGCCCG
>probe:Drosophila_2:1633968_at:53:355; Interrogation_Position=1856; Antisense; GCACCCGCATCGAGTACTATGTGAC
>probe:Drosophila_2:1633968_at:509:483; Interrogation_Position=1886; Antisense; GTAGGCTAAGCTAACCCATGGCATT
>probe:Drosophila_2:1633968_at:381:569; Interrogation_Position=1942; Antisense; GGCTAAACTTTGATCCTAAGGCACA
>probe:Drosophila_2:1633968_at:421:485; Interrogation_Position=1990; Antisense; GTAGGCTAGCTTGTGTTTCGACATC
>probe:Drosophila_2:1633968_at:652:401; Interrogation_Position=2009; Antisense; GACATCTGTGATATAGTGCTTGACT
>probe:Drosophila_2:1633968_at:80:49; Interrogation_Position=2101; Antisense; ATCCATGCCTTCGTAGTCCTAAGCT
>probe:Drosophila_2:1633968_at:479:659; Interrogation_Position=2120; Antisense; TAAGCTCGCCCTTAGAAATCGATTT
>probe:Drosophila_2:1633968_at:350:291; Interrogation_Position=2146; Antisense; CGTATTTATAGAACCGACCGACATA
>probe:Drosophila_2:1633968_at:6:413; Interrogation_Position=2161; Antisense; GACCGACATATGACTAAGCCAGCAG

Paste this into a BLAST search page for me
GTCTCTGTTCTCGAATTCATTGCAAGCAAGTATTACCACATTCCGTATTTGAAACCACAATCTGCAGTTGCCGTTGCAGTTGCCGTTCTAGTCACATAAGTGGAAAGTATTATTCGCCACGCCCGGCACCCGCATCGAGTACTATGTGACGTAGGCTAAGCTAACCCATGGCATTGGCTAAACTTTGATCCTAAGGCACAGTAGGCTAGCTTGTGTTTCGACATCGACATCTGTGATATAGTGCTTGACTATCCATGCCTTCGTAGTCCTAAGCTTAAGCTCGCCCTTAGAAATCGATTTCGTATTTATAGAACCGACCGACATAGACCGACATATGACTAAGCCAGCAG

Full Affymetrix probeset data:

Annotations for 1633968_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720