Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633969_at:

>probe:Drosophila_2:1633969_at:396:205; Interrogation_Position=470; Antisense; AAGCTTGCACATCTTCGAGGGCATC
>probe:Drosophila_2:1633969_at:414:593; Interrogation_Position=496; Antisense; TGTCTTCCCCAGAGATTTCCATTTA
>probe:Drosophila_2:1633969_at:345:521; Interrogation_Position=537; Antisense; GTGGCTGCTCCGAATAGTACTGATA
>probe:Drosophila_2:1633969_at:514:455; Interrogation_Position=558; Antisense; GATAACGCTACAAGGCCTGACGATG
>probe:Drosophila_2:1633969_at:430:1; Interrogation_Position=602; Antisense; CTTAACCTGGTTCGATCAATTGGCA
>probe:Drosophila_2:1633969_at:590:729; Interrogation_Position=633; Antisense; TTGGCCAAGGGCTTAACCACACACA
>probe:Drosophila_2:1633969_at:1:609; Interrogation_Position=772; Antisense; TGACTGCTTTGGGAGCCATCTTAGT
>probe:Drosophila_2:1633969_at:78:65; Interrogation_Position=801; Antisense; ATGGGCTTTCAAATGCTTTCGATAG
>probe:Drosophila_2:1633969_at:432:559; Interrogation_Position=831; Antisense; GGAAAAGCTCTATTACTGGCCAAGA
>probe:Drosophila_2:1633969_at:720:579; Interrogation_Position=847; Antisense; TGGCCAAGATGGCTCTGCTCTTAGC
>probe:Drosophila_2:1633969_at:256:227; Interrogation_Position=903; Antisense; AATGGATTGCACTATGGACTGTACC
>probe:Drosophila_2:1633969_at:311:555; Interrogation_Position=918; Antisense; GGACTGTACCACGTACCTGGAGAAC
>probe:Drosophila_2:1633969_at:583:507; Interrogation_Position=972; Antisense; GTGAGTCACCCCAGAAATGTGCCTA
>probe:Drosophila_2:1633969_at:366:167; Interrogation_Position=986; Antisense; AAATGTGCCTATTCCCGTAGCAGTG

Paste this into a BLAST search page for me
AAGCTTGCACATCTTCGAGGGCATCTGTCTTCCCCAGAGATTTCCATTTAGTGGCTGCTCCGAATAGTACTGATAGATAACGCTACAAGGCCTGACGATGCTTAACCTGGTTCGATCAATTGGCATTGGCCAAGGGCTTAACCACACACATGACTGCTTTGGGAGCCATCTTAGTATGGGCTTTCAAATGCTTTCGATAGGGAAAAGCTCTATTACTGGCCAAGATGGCCAAGATGGCTCTGCTCTTAGCAATGGATTGCACTATGGACTGTACCGGACTGTACCACGTACCTGGAGAACGTGAGTCACCCCAGAAATGTGCCTAAAATGTGCCTATTCCCGTAGCAGTG

Full Affymetrix probeset data:

Annotations for 1633969_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime