FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633971_at:

>probe:Drosophila_2:1633971_at:133:149; Interrogation_Position=2760; Antisense; AATCCGTCGGCCATTAGAAACCACT
>probe:Drosophila_2:1633971_at:613:587; Interrogation_Position=2797; Antisense; TGGAGGGAGCCCTGCAGATGTACTC
>probe:Drosophila_2:1633971_at:277:99; Interrogation_Position=2812; Antisense; AGATGTACTCCAGCCAGGACGACAT
>probe:Drosophila_2:1633971_at:606:245; Interrogation_Position=2858; Antisense; GAATTTCACCAACAACCGGAGGGCT
>probe:Drosophila_2:1633971_at:552:39; Interrogation_Position=2906; Antisense; ATCTGCGGGATTGCCGAGCTTTCAT
>probe:Drosophila_2:1633971_at:67:711; Interrogation_Position=2933; Antisense; TTCGGCGGAACCCAAGAGCTTAGCT
>probe:Drosophila_2:1633971_at:393:101; Interrogation_Position=2947; Antisense; AGAGCTTAGCTGAACGTCCGGCAAC
>probe:Drosophila_2:1633971_at:262:109; Interrogation_Position=2983; Antisense; AGAAGACGTCCAAGTCGGCGCACTC
>probe:Drosophila_2:1633971_at:230:323; Interrogation_Position=3091; Antisense; GCGCAGGACCCTTCCAGAGGATGGA
>probe:Drosophila_2:1633971_at:342:439; Interrogation_Position=3114; Antisense; GAGGCCCGATTGGATGCGACTGCTC
>probe:Drosophila_2:1633971_at:487:483; Interrogation_Position=3148; Antisense; GTAGAACGGGAACTGCACCCCTTAT
>probe:Drosophila_2:1633971_at:24:441; Interrogation_Position=3174; Antisense; GAGGCCATACAGTCCGAGCTACGAA
>probe:Drosophila_2:1633971_at:221:91; Interrogation_Position=3217; Antisense; AGTAGAGCCCACAACGGATGATCTT
>probe:Drosophila_2:1633971_at:237:575; Interrogation_Position=3259; Antisense; GGCGTATCATTCATGTCCGAACCAA

Paste this into a BLAST search page for me
AATCCGTCGGCCATTAGAAACCACTTGGAGGGAGCCCTGCAGATGTACTCAGATGTACTCCAGCCAGGACGACATGAATTTCACCAACAACCGGAGGGCTATCTGCGGGATTGCCGAGCTTTCATTTCGGCGGAACCCAAGAGCTTAGCTAGAGCTTAGCTGAACGTCCGGCAACAGAAGACGTCCAAGTCGGCGCACTCGCGCAGGACCCTTCCAGAGGATGGAGAGGCCCGATTGGATGCGACTGCTCGTAGAACGGGAACTGCACCCCTTATGAGGCCATACAGTCCGAGCTACGAAAGTAGAGCCCACAACGGATGATCTTGGCGTATCATTCATGTCCGAACCAA

Full Affymetrix probeset data:

Annotations for 1633971_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720