FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633972_at:

>probe:Drosophila_2:1633972_at:340:231; Interrogation_Position=337; Antisense; AATGATAACCTTAGCCAGGCCTATG
>probe:Drosophila_2:1633972_at:102:217; Interrogation_Position=438; Antisense; AAGTTACGCCTATGACAGTCAACCT
>probe:Drosophila_2:1633972_at:580:33; Interrogation_Position=464; Antisense; ATCAGTATGACTACGGACCATCCAA
>probe:Drosophila_2:1633972_at:462:413; Interrogation_Position=479; Antisense; GACCATCCAACGGACATGGCTATGA
>probe:Drosophila_2:1633972_at:117:69; Interrogation_Position=494; Antisense; ATGGCTATGAGCCAGGACCTGCTCC
>probe:Drosophila_2:1633972_at:721:531; Interrogation_Position=551; Antisense; GGGTGCCATACCACGTTTATCGACC
>probe:Drosophila_2:1633972_at:15:699; Interrogation_Position=566; Antisense; TTTATCGACCTCGACCCGAACATGG
>probe:Drosophila_2:1633972_at:427:523; Interrogation_Position=601; Antisense; GGGCCAGCAGTGGATTACTCCTACA
>probe:Drosophila_2:1633972_at:219:259; Interrogation_Position=646; Antisense; CACGAGATAGTCTCCCACAAGGGAT
>probe:Drosophila_2:1633972_at:312:223; Interrogation_Position=664; Antisense; AAGGGATCGCCAGAGATCTCACCAA
>probe:Drosophila_2:1633972_at:505:101; Interrogation_Position=675; Antisense; AGAGATCTCACCAAAGGCCTTGCTG
>probe:Drosophila_2:1633972_at:259:183; Interrogation_Position=703; Antisense; AAAAGCTTCCTGATTCCGCTGGCCA
>probe:Drosophila_2:1633972_at:726:515; Interrogation_Position=818; Antisense; GTGTCGGACCTACAGTCGTTGGCAA
>probe:Drosophila_2:1633972_at:114:121; Interrogation_Position=869; Antisense; AGCGGGCTTTACGATCAGGGAATAC

Paste this into a BLAST search page for me
AATGATAACCTTAGCCAGGCCTATGAAGTTACGCCTATGACAGTCAACCTATCAGTATGACTACGGACCATCCAAGACCATCCAACGGACATGGCTATGAATGGCTATGAGCCAGGACCTGCTCCGGGTGCCATACCACGTTTATCGACCTTTATCGACCTCGACCCGAACATGGGGGCCAGCAGTGGATTACTCCTACACACGAGATAGTCTCCCACAAGGGATAAGGGATCGCCAGAGATCTCACCAAAGAGATCTCACCAAAGGCCTTGCTGAAAAGCTTCCTGATTCCGCTGGCCAGTGTCGGACCTACAGTCGTTGGCAAAGCGGGCTTTACGATCAGGGAATAC

Full Affymetrix probeset data:

Annotations for 1633972_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720