FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633973_at:

>probe:Drosophila_2:1633973_at:122:79; Interrogation_Position=111; Antisense; AGGTTATCTACAACACCCTGTTCAA
>probe:Drosophila_2:1633973_at:76:39; Interrogation_Position=116; Antisense; ATCTACAACACCCTGTTCAAGCGCA
>probe:Drosophila_2:1633973_at:378:493; Interrogation_Position=13; Antisense; GTCAACTCAACCTAACAAATCAGCT
>probe:Drosophila_2:1633973_at:245:673; Interrogation_Position=149; Antisense; TACGCCGTGGCCATCATCGCGTCGG
>probe:Drosophila_2:1633973_at:543:43; Interrogation_Position=164; Antisense; ATCGCGTCGGCCTTTTTCTTCGAGC
>probe:Drosophila_2:1633973_at:541:415; Interrogation_Position=185; Antisense; GAGCGCGCTCTCGATGTCACGTCGG
>probe:Drosophila_2:1633973_at:36:61; Interrogation_Position=198; Antisense; ATGTCACGTCGGTTGCGATTTTCGA
>probe:Drosophila_2:1633973_at:137:291; Interrogation_Position=207; Antisense; CGGTTGCGATTTTCGAGGGCATCAA
>probe:Drosophila_2:1633973_at:337:525; Interrogation_Position=223; Antisense; GGGCATCAACAAAGGCAAACTCTGG
>probe:Drosophila_2:1633973_at:636:193; Interrogation_Position=240; Antisense; AACTCTGGAAGGACATCAAGGGCAA
>probe:Drosophila_2:1633973_at:643:163; Interrogation_Position=29; Antisense; AAATCAGCTGTGAGTTTGGCGTGTG
>probe:Drosophila_2:1633973_at:483:465; Interrogation_Position=64; Antisense; GATTGGGAACAAATCGGACGTCTTT
>probe:Drosophila_2:1633973_at:517:213; Interrogation_Position=80; Antisense; GACGTCTTTAACAAAAATCTAGCCA
>probe:Drosophila_2:1633973_at:525:237; Interrogation_Position=95; Antisense; AATCTAGCCAACATGAAGGTTATCT

Paste this into a BLAST search page for me
AGGTTATCTACAACACCCTGTTCAAATCTACAACACCCTGTTCAAGCGCAGTCAACTCAACCTAACAAATCAGCTTACGCCGTGGCCATCATCGCGTCGGATCGCGTCGGCCTTTTTCTTCGAGCGAGCGCGCTCTCGATGTCACGTCGGATGTCACGTCGGTTGCGATTTTCGACGGTTGCGATTTTCGAGGGCATCAAGGGCATCAACAAAGGCAAACTCTGGAACTCTGGAAGGACATCAAGGGCAAAAATCAGCTGTGAGTTTGGCGTGTGGATTGGGAACAAATCGGACGTCTTTGACGTCTTTAACAAAAATCTAGCCAAATCTAGCCAACATGAAGGTTATCT

Full Affymetrix probeset data:

Annotations for 1633973_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720