FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633980_at:

>probe:Drosophila_2:1633980_at:209:115; Interrogation_Position=1069; Antisense; AGCAGGAACCTGAACTGGACGCGCC
>probe:Drosophila_2:1633980_at:686:291; Interrogation_Position=1121; Antisense; CGTGCTGTCCACTTCAACAGAGGAT
>probe:Drosophila_2:1633980_at:427:265; Interrogation_Position=1138; Antisense; CAGAGGATCCTGTTGCAATCTCCGC
>probe:Drosophila_2:1633980_at:246:45; Interrogation_Position=1176; Antisense; ATCGCCAATGTATTGATCGGTGCTG
>probe:Drosophila_2:1633980_at:103:387; Interrogation_Position=1201; Antisense; GAACACACCTGTTGGACGAGTCCAG
>probe:Drosophila_2:1633980_at:432:87; Interrogation_Position=1219; Antisense; AGTCCAGTGATGAAGAACCTCCTAG
>probe:Drosophila_2:1633980_at:170:389; Interrogation_Position=1247; Antisense; GAAAAAGGTTGCTCACAGTCCCGCA
>probe:Drosophila_2:1633980_at:114:47; Interrogation_Position=1271; Antisense; ATCCGACTACTCCAGTGACGATGAG
>probe:Drosophila_2:1633980_at:607:137; Interrogation_Position=1288; Antisense; ACGATGAGCCTCTTGAAAAGCCCAA
>probe:Drosophila_2:1633980_at:362:723; Interrogation_Position=1300; Antisense; TTGAAAAGCCCAAACGCGCGTAACA
>probe:Drosophila_2:1633980_at:660:437; Interrogation_Position=1344; Antisense; GAGGAACCTTCGATATCAGCGTAAG
>probe:Drosophila_2:1633980_at:358:17; Interrogation_Position=1434; Antisense; ATTTTATTATCTTCTATGCTTCTCA
>probe:Drosophila_2:1633980_at:181:19; Interrogation_Position=1468; Antisense; ATATATTGCCTTGAGCCTAACCAAA
>probe:Drosophila_2:1633980_at:85:183; Interrogation_Position=1618; Antisense; AAAACTGCACTTAAGCCTACGCGTT

Paste this into a BLAST search page for me
AGCAGGAACCTGAACTGGACGCGCCCGTGCTGTCCACTTCAACAGAGGATCAGAGGATCCTGTTGCAATCTCCGCATCGCCAATGTATTGATCGGTGCTGGAACACACCTGTTGGACGAGTCCAGAGTCCAGTGATGAAGAACCTCCTAGGAAAAAGGTTGCTCACAGTCCCGCAATCCGACTACTCCAGTGACGATGAGACGATGAGCCTCTTGAAAAGCCCAATTGAAAAGCCCAAACGCGCGTAACAGAGGAACCTTCGATATCAGCGTAAGATTTTATTATCTTCTATGCTTCTCAATATATTGCCTTGAGCCTAACCAAAAAAACTGCACTTAAGCCTACGCGTT

Full Affymetrix probeset data:

Annotations for 1633980_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720