FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633982_at:

>probe:Drosophila_2:1633982_at:437:463; Interrogation_Position=1696; Antisense; GATTCCGACGGCGAGATGATCGACA
>probe:Drosophila_2:1633982_at:269:547; Interrogation_Position=1737; Antisense; GGAGGAATTTGACCTTCCCACCAAT
>probe:Drosophila_2:1633982_at:42:223; Interrogation_Position=1828; Antisense; AAGGGTTCAATTGCCTTGACTGCCC
>probe:Drosophila_2:1633982_at:42:611; Interrogation_Position=1844; Antisense; TGACTGCCCATCTTCGACTGATCGA
>probe:Drosophila_2:1633982_at:322:613; Interrogation_Position=1871; Antisense; TGAACTGCAGTGCTTTGGACTCCTG
>probe:Drosophila_2:1633982_at:348:405; Interrogation_Position=1888; Antisense; GACTCCTGGCTGCTACGTTATATTA
>probe:Drosophila_2:1633982_at:55:211; Interrogation_Position=1919; Antisense; AAGAATCCCTTAGTCTCTTGATCAA
>probe:Drosophila_2:1633982_at:368:197; Interrogation_Position=1985; Antisense; AACGGAATCGTCTTCTGCCATTGAA
>probe:Drosophila_2:1633982_at:262:509; Interrogation_Position=2029; Antisense; GTGAACTTGCGTCTGGATGAAGCCC
>probe:Drosophila_2:1633982_at:439:379; Interrogation_Position=2047; Antisense; GAAGCCCAATTTTTAAGCATCGCTA
>probe:Drosophila_2:1633982_at:606:635; Interrogation_Position=2066; Antisense; TCGCTAAACTGCTGCACGTTTTGAA
>probe:Drosophila_2:1633982_at:697:367; Interrogation_Position=2088; Antisense; GAAGGACGAGACAATTGGGCCGCAA
>probe:Drosophila_2:1633982_at:63:671; Interrogation_Position=2206; Antisense; TACGAGGGCAGGCTAACACCTTTGC
>probe:Drosophila_2:1633982_at:581:625; Interrogation_Position=2228; Antisense; TGCCCTCTGGTCCATTGAATCTTTG

Paste this into a BLAST search page for me
GATTCCGACGGCGAGATGATCGACAGGAGGAATTTGACCTTCCCACCAATAAGGGTTCAATTGCCTTGACTGCCCTGACTGCCCATCTTCGACTGATCGATGAACTGCAGTGCTTTGGACTCCTGGACTCCTGGCTGCTACGTTATATTAAAGAATCCCTTAGTCTCTTGATCAAAACGGAATCGTCTTCTGCCATTGAAGTGAACTTGCGTCTGGATGAAGCCCGAAGCCCAATTTTTAAGCATCGCTATCGCTAAACTGCTGCACGTTTTGAAGAAGGACGAGACAATTGGGCCGCAATACGAGGGCAGGCTAACACCTTTGCTGCCCTCTGGTCCATTGAATCTTTG

Full Affymetrix probeset data:

Annotations for 1633982_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720