FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633984_at:

>probe:Drosophila_2:1633984_at:156:45; Interrogation_Position=1048; Antisense; ATCGAATGGCTGTCGCTGCAATTGA
>probe:Drosophila_2:1633984_at:611:247; Interrogation_Position=1067; Antisense; AATTGACTTGGCAGCACACGCACGT
>probe:Drosophila_2:1633984_at:238:291; Interrogation_Position=1089; Antisense; CGTCACTATCTTTGGCGTATTTCGC
>probe:Drosophila_2:1633984_at:32:31; Interrogation_Position=1114; Antisense; ATAAATCGCTCTTTGGCTTTCCGGA
>probe:Drosophila_2:1633984_at:641:337; Interrogation_Position=1164; Antisense; GCTCTACATGGTGCAATCCGACTAT
>probe:Drosophila_2:1633984_at:488:603; Interrogation_Position=611; Antisense; TGTTCGCCATCCTAGCTGAGATAAC
>probe:Drosophila_2:1633984_at:459:441; Interrogation_Position=669; Antisense; GATGGTACTCCTGAATCGGCAGTTA
>probe:Drosophila_2:1633984_at:192:653; Interrogation_Position=694; Antisense; TCAACGGTCGCCTTCAATTTATGGG
>probe:Drosophila_2:1633984_at:286:725; Interrogation_Position=722; Antisense; TTGAGAGGCTGCACACCAGGTTTCA
>probe:Drosophila_2:1633984_at:449:517; Interrogation_Position=772; Antisense; GTGTGTTCCATCTTCAGGTATGTCA
>probe:Drosophila_2:1633984_at:474:313; Interrogation_Position=802; Antisense; GCCTACATGGCACGCAATCTTTGGA
>probe:Drosophila_2:1633984_at:342:543; Interrogation_Position=841; Antisense; GGATATCTTTTGGTACGCTTCGTTA
>probe:Drosophila_2:1633984_at:508:515; Interrogation_Position=895; Antisense; GTGTACCTGGTTTTCTCTTTCATTA
>probe:Drosophila_2:1633984_at:305:607; Interrogation_Position=935; Antisense; TGATGCTCTCTCTCTTGGTGAATAG

Paste this into a BLAST search page for me
ATCGAATGGCTGTCGCTGCAATTGAAATTGACTTGGCAGCACACGCACGTCGTCACTATCTTTGGCGTATTTCGCATAAATCGCTCTTTGGCTTTCCGGAGCTCTACATGGTGCAATCCGACTATTGTTCGCCATCCTAGCTGAGATAACGATGGTACTCCTGAATCGGCAGTTATCAACGGTCGCCTTCAATTTATGGGTTGAGAGGCTGCACACCAGGTTTCAGTGTGTTCCATCTTCAGGTATGTCAGCCTACATGGCACGCAATCTTTGGAGGATATCTTTTGGTACGCTTCGTTAGTGTACCTGGTTTTCTCTTTCATTATGATGCTCTCTCTCTTGGTGAATAG

Full Affymetrix probeset data:

Annotations for 1633984_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720