FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633986_at:

>probe:Drosophila_2:1633986_at:276:243; Interrogation_Position=2370; Antisense; AATTTATTACGTTGTGTGCCCTCTG
>probe:Drosophila_2:1633986_at:629:597; Interrogation_Position=2384; Antisense; TGTGCCCTCTGTTGTAATGTCTTAC
>probe:Drosophila_2:1633986_at:146:59; Interrogation_Position=2400; Antisense; ATGTCTTACTTTTTACTTTGTGCAA
>probe:Drosophila_2:1633986_at:461:345; Interrogation_Position=2435; Antisense; GCATATATTCTTAGCCGTTCTCGTG
>probe:Drosophila_2:1633986_at:610:471; Interrogation_Position=2451; Antisense; GTTCTCGTGCAATCGACGACTTTTC
>probe:Drosophila_2:1633986_at:158:695; Interrogation_Position=2472; Antisense; TTTCGCCCATATCAAAAGCAACTCG
>probe:Drosophila_2:1633986_at:95:209; Interrogation_Position=2487; Antisense; AAGCAACTCGAATGTAGCCTATACT
>probe:Drosophila_2:1633986_at:720:319; Interrogation_Position=2610; Antisense; GCCGCGGTGGCGAAAGCGACATTAC
>probe:Drosophila_2:1633986_at:254:211; Interrogation_Position=2661; Antisense; AAGAAGGGTTGTACTCCGCATGCAA
>probe:Drosophila_2:1633986_at:18:489; Interrogation_Position=2671; Antisense; GTACTCCGCATGCAAGGGCTATTTA
>probe:Drosophila_2:1633986_at:512:19; Interrogation_Position=2697; Antisense; ATATATATTTTAACCCGCCCGAGCT
>probe:Drosophila_2:1633986_at:683:417; Interrogation_Position=2717; Antisense; GAGCTCACCATTACCAGAAATTCGA
>probe:Drosophila_2:1633986_at:112:399; Interrogation_Position=2775; Antisense; GACACCTGCAACCATAAGTATTTAC
>probe:Drosophila_2:1633986_at:534:17; Interrogation_Position=2794; Antisense; ATTTACCTAGCTGATGTGTGGGAAT

Paste this into a BLAST search page for me
AATTTATTACGTTGTGTGCCCTCTGTGTGCCCTCTGTTGTAATGTCTTACATGTCTTACTTTTTACTTTGTGCAAGCATATATTCTTAGCCGTTCTCGTGGTTCTCGTGCAATCGACGACTTTTCTTTCGCCCATATCAAAAGCAACTCGAAGCAACTCGAATGTAGCCTATACTGCCGCGGTGGCGAAAGCGACATTACAAGAAGGGTTGTACTCCGCATGCAAGTACTCCGCATGCAAGGGCTATTTAATATATATTTTAACCCGCCCGAGCTGAGCTCACCATTACCAGAAATTCGAGACACCTGCAACCATAAGTATTTACATTTACCTAGCTGATGTGTGGGAAT

Full Affymetrix probeset data:

Annotations for 1633986_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720