FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633989_at:

>probe:Drosophila_2:1633989_at:142:179; Interrogation_Position=1003; Antisense; AAACTCTGCGCATTTGTCTGGGTCA
>probe:Drosophila_2:1633989_at:615:529; Interrogation_Position=1022; Antisense; GGGTCAATAATGTCCTAGATTCCGA
>probe:Drosophila_2:1633989_at:406:7; Interrogation_Position=1092; Antisense; ATTGCGTAGAGTCGTATTCACCCTG
>probe:Drosophila_2:1633989_at:140:527; Interrogation_Position=568; Antisense; GGGACTTCCATGCTAACTTCGAGGG
>probe:Drosophila_2:1633989_at:590:147; Interrogation_Position=583; Antisense; ACTTCGAGGGTGTGAGTGCCGATCT
>probe:Drosophila_2:1633989_at:450:73; Interrogation_Position=611; Antisense; AGGAAAGACATCCATTCACGCCTTC
>probe:Drosophila_2:1633989_at:302:447; Interrogation_Position=660; Antisense; GATGCTCTCAGCTTGGTTCTGGATG
>probe:Drosophila_2:1633989_at:607:229; Interrogation_Position=698; Antisense; AATGAGCATCTCAGGTGCCTTCAAC
>probe:Drosophila_2:1633989_at:134:237; Interrogation_Position=726; Antisense; AATCGAATTCTGCTGGAGGCCACCA
>probe:Drosophila_2:1633989_at:410:217; Interrogation_Position=775; Antisense; AAGTCGTTTTGGAGGCTATGCAGGC
>probe:Drosophila_2:1633989_at:576:247; Interrogation_Position=814; Antisense; AATTGGCTAGCGAGTTCGGCAAACT
>probe:Drosophila_2:1633989_at:88:635; Interrogation_Position=838; Antisense; TCGCCAACCAGCTCCTGAAGAATGT
>probe:Drosophila_2:1633989_at:507:421; Interrogation_Position=870; Antisense; GAGCAATTCTACGTGGACTAGGCCT
>probe:Drosophila_2:1633989_at:603:553; Interrogation_Position=884; Antisense; GGACTAGGCCTTAATCCCTTAGATT

Paste this into a BLAST search page for me
AAACTCTGCGCATTTGTCTGGGTCAGGGTCAATAATGTCCTAGATTCCGAATTGCGTAGAGTCGTATTCACCCTGGGGACTTCCATGCTAACTTCGAGGGACTTCGAGGGTGTGAGTGCCGATCTAGGAAAGACATCCATTCACGCCTTCGATGCTCTCAGCTTGGTTCTGGATGAATGAGCATCTCAGGTGCCTTCAACAATCGAATTCTGCTGGAGGCCACCAAAGTCGTTTTGGAGGCTATGCAGGCAATTGGCTAGCGAGTTCGGCAAACTTCGCCAACCAGCTCCTGAAGAATGTGAGCAATTCTACGTGGACTAGGCCTGGACTAGGCCTTAATCCCTTAGATT

Full Affymetrix probeset data:

Annotations for 1633989_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720