Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633990_at:

>probe:Drosophila_2:1633990_at:121:129; Interrogation_Position=2414; Antisense; ACCAGGCTTTTGGTGTGCTCCGGCA
>probe:Drosophila_2:1633990_at:445:567; Interrogation_Position=2435; Antisense; GGCACATACTTCCACTTGAGCGGAG
>probe:Drosophila_2:1633990_at:491:331; Interrogation_Position=2454; Antisense; GCGGAGCTACATTCAGTTCGCTGCC
>probe:Drosophila_2:1633990_at:596:533; Interrogation_Position=2495; Antisense; GGTGTGATATCCACGGGCGACTGAC
>probe:Drosophila_2:1633990_at:595:405; Interrogation_Position=2517; Antisense; GACGATGTCCCGACGCCTGTGGGTA
>probe:Drosophila_2:1633990_at:459:593; Interrogation_Position=2536; Antisense; TGGGTACTCCTTGGCCCAGTGGGCA
>probe:Drosophila_2:1633990_at:661:573; Interrogation_Position=2548; Antisense; GGCCCAGTGGGCAGGTCCTGAAATA
>probe:Drosophila_2:1633990_at:561:195; Interrogation_Position=2599; Antisense; AACGTGCGGCAAAGTCATTAGGTAT
>probe:Drosophila_2:1633990_at:231:269; Interrogation_Position=2614; Antisense; CATTAGGTATTTGCTTTCCCCGAAT
>probe:Drosophila_2:1633990_at:659:145; Interrogation_Position=2650; Antisense; ACTAAGTGCTAATTCGCTGTGTCGA
>probe:Drosophila_2:1633990_at:53:181; Interrogation_Position=2732; Antisense; AAAAACTCATTAGGCTGGTCAGGAA
>probe:Drosophila_2:1633990_at:257:693; Interrogation_Position=2837; Antisense; TTAGGGCGACTATTATATGGTACTA
>probe:Drosophila_2:1633990_at:89:713; Interrogation_Position=2895; Antisense; TTCATTTATTCCTACAATTTGCTGT
>probe:Drosophila_2:1633990_at:235:191; Interrogation_Position=2970; Antisense; AACTAGAATCTGGACTTTGAAGCTA

Paste this into a BLAST search page for me
ACCAGGCTTTTGGTGTGCTCCGGCAGGCACATACTTCCACTTGAGCGGAGGCGGAGCTACATTCAGTTCGCTGCCGGTGTGATATCCACGGGCGACTGACGACGATGTCCCGACGCCTGTGGGTATGGGTACTCCTTGGCCCAGTGGGCAGGCCCAGTGGGCAGGTCCTGAAATAAACGTGCGGCAAAGTCATTAGGTATCATTAGGTATTTGCTTTCCCCGAATACTAAGTGCTAATTCGCTGTGTCGAAAAAACTCATTAGGCTGGTCAGGAATTAGGGCGACTATTATATGGTACTATTCATTTATTCCTACAATTTGCTGTAACTAGAATCTGGACTTTGAAGCTA

Full Affymetrix probeset data:

Annotations for 1633990_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime