Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633991_at:

>probe:Drosophila_2:1633991_at:52:435; Interrogation_Position=2462; Antisense; GAGGTTTGGATACTGCAGCGTTACA
>probe:Drosophila_2:1633991_at:307:75; Interrogation_Position=2526; Antisense; AGGACTCATCGCTGTGCTTTCAGGC
>probe:Drosophila_2:1633991_at:158:99; Interrogation_Position=2561; Antisense; AGAGAGGTGGGCTTCCTCCTGGCCA
>probe:Drosophila_2:1633991_at:256:283; Interrogation_Position=2576; Antisense; CTCCTGGCCAAGCAGTACTTCATAG
>probe:Drosophila_2:1633991_at:236:137; Interrogation_Position=2639; Antisense; ACGAGAGTCATGTCCCGACTGTTGA
>probe:Drosophila_2:1633991_at:15:721; Interrogation_Position=2660; Antisense; TTGACGCCGTTATCCGAGCAAGTTA
>probe:Drosophila_2:1633991_at:483:387; Interrogation_Position=2701; Antisense; GAACAAGTTCAGGTCCTTTGCCAAC
>probe:Drosophila_2:1633991_at:318:183; Interrogation_Position=2723; Antisense; AACGATTCCCGACATTTCCTGAAGG
>probe:Drosophila_2:1633991_at:366:83; Interrogation_Position=2745; Antisense; AGGGCATTCGTCAGGCGATGCAGCA
>probe:Drosophila_2:1633991_at:665:125; Interrogation_Position=2771; Antisense; AGCCTGGAGACGATGCTCACGAATG
>probe:Drosophila_2:1633991_at:222:665; Interrogation_Position=2821; Antisense; TAAATTCTCACGGACTATACGCCAC
>probe:Drosophila_2:1633991_at:251:133; Interrogation_Position=2839; Antisense; ACGCCACCATTTGTAATGCTCACGA
>probe:Drosophila_2:1633991_at:31:369; Interrogation_Position=2862; Antisense; GAATGAGTTTAGATCCTCCCAGGAA
>probe:Drosophila_2:1633991_at:644:213; Interrogation_Position=2935; Antisense; AAGATTACCCGTTTCTCAGATAGTG

Paste this into a BLAST search page for me
GAGGTTTGGATACTGCAGCGTTACAAGGACTCATCGCTGTGCTTTCAGGCAGAGAGGTGGGCTTCCTCCTGGCCACTCCTGGCCAAGCAGTACTTCATAGACGAGAGTCATGTCCCGACTGTTGATTGACGCCGTTATCCGAGCAAGTTAGAACAAGTTCAGGTCCTTTGCCAACAACGATTCCCGACATTTCCTGAAGGAGGGCATTCGTCAGGCGATGCAGCAAGCCTGGAGACGATGCTCACGAATGTAAATTCTCACGGACTATACGCCACACGCCACCATTTGTAATGCTCACGAGAATGAGTTTAGATCCTCCCAGGAAAAGATTACCCGTTTCTCAGATAGTG

Full Affymetrix probeset data:

Annotations for 1633991_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime