Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633992_at:

>probe:Drosophila_2:1633992_at:493:553; Interrogation_Position=1818; Antisense; GGAGCTGAACTGGTCGCGAGATCAA
>probe:Drosophila_2:1633992_at:139:385; Interrogation_Position=1868; Antisense; GAACTTTTCTTAACTCCCAGATGGG
>probe:Drosophila_2:1633992_at:361:343; Interrogation_Position=1912; Antisense; GCTTCGCAGATGAGCATTCCCATTA
>probe:Drosophila_2:1633992_at:158:221; Interrogation_Position=1952; Antisense; AAGTGCGCAAGTTTGCCGGGCAGTT
>probe:Drosophila_2:1633992_at:294:489; Interrogation_Position=2004; Antisense; GTACGTGTCGATTGCAGACTGCTGC
>probe:Drosophila_2:1633992_at:588:401; Interrogation_Position=2092; Antisense; GACATTGATGTCCATGCCCAGGGCA
>probe:Drosophila_2:1633992_at:602:201; Interrogation_Position=2122; Antisense; AACCTGTATGAGTTCCTTCTGCTCA
>probe:Drosophila_2:1633992_at:675:269; Interrogation_Position=2145; Antisense; CATGTCGGCTATTGTGCAGGGCAAC
>probe:Drosophila_2:1633992_at:201:355; Interrogation_Position=2188; Antisense; GCACGGCTGTATCTGGACCACAAAA
>probe:Drosophila_2:1633992_at:404:353; Interrogation_Position=2228; Antisense; GCAACTTTCCCACCGTAATGCAAAT
>probe:Drosophila_2:1633992_at:227:1; Interrogation_Position=2289; Antisense; GTTGTAACCCTCTCCAGTTTGGAAT
>probe:Drosophila_2:1633992_at:111:145; Interrogation_Position=2314; Antisense; ACTGCATCCGTTAAGCGTTGTCTAC
>probe:Drosophila_2:1633992_at:559:467; Interrogation_Position=2330; Antisense; GTTGTCTACGCATTACACGTCGAAG
>probe:Drosophila_2:1633992_at:531:529; Interrogation_Position=2367; Antisense; GGGATCGCTGCCTCAACTTTAATTT

Paste this into a BLAST search page for me
GGAGCTGAACTGGTCGCGAGATCAAGAACTTTTCTTAACTCCCAGATGGGGCTTCGCAGATGAGCATTCCCATTAAAGTGCGCAAGTTTGCCGGGCAGTTGTACGTGTCGATTGCAGACTGCTGCGACATTGATGTCCATGCCCAGGGCAAACCTGTATGAGTTCCTTCTGCTCACATGTCGGCTATTGTGCAGGGCAACGCACGGCTGTATCTGGACCACAAAAGCAACTTTCCCACCGTAATGCAAATGTTGTAACCCTCTCCAGTTTGGAATACTGCATCCGTTAAGCGTTGTCTACGTTGTCTACGCATTACACGTCGAAGGGGATCGCTGCCTCAACTTTAATTT

Full Affymetrix probeset data:

Annotations for 1633992_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime