FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633994_at:

>probe:Drosophila_2:1633994_at:203:363; Interrogation_Position=253; Antisense; GCAATACTACGGATTTCGCGCGGAG
>probe:Drosophila_2:1633994_at:201:225; Interrogation_Position=324; Antisense; AAGGATGTTCCTTTGTCTACAATAG
>probe:Drosophila_2:1633994_at:661:657; Interrogation_Position=360; Antisense; TAAGTGGCCTATTTCACTCTCCGAA
>probe:Drosophila_2:1633994_at:410:393; Interrogation_Position=446; Antisense; GAAAGAGTTGTGCTTCACTTCACAT
>probe:Drosophila_2:1633994_at:46:585; Interrogation_Position=490; Antisense; TGGAAGTTGTGACCACCAAACCGCC
>probe:Drosophila_2:1633994_at:457:201; Interrogation_Position=508; Antisense; AACCGCCAGCGATTACATCGAGTTT
>probe:Drosophila_2:1633994_at:611:429; Interrogation_Position=527; Antisense; GAGTTTTCCAATTTCATGAGCACGG
>probe:Drosophila_2:1633994_at:684:455; Interrogation_Position=567; Antisense; GATACTGCGGAAAGCTTCCCGATTT
>probe:Drosophila_2:1633994_at:432:439; Interrogation_Position=605; Antisense; GATGGACGTTTCTTTCGAGTCACCT
>probe:Drosophila_2:1633994_at:505:637; Interrogation_Position=619; Antisense; TCGAGTCACCTTGCATTCCAATGAT
>probe:Drosophila_2:1633994_at:638:721; Interrogation_Position=634; Antisense; TTCCAATGATCGCTTTGTGGCCATC
>probe:Drosophila_2:1633994_at:250:453; Interrogation_Position=713; Antisense; GATCTTCGGGATAATGCCTCCATGC
>probe:Drosophila_2:1633994_at:208:97; Interrogation_Position=738; Antisense; AGAGTTTCGTCTCAACAGCGTCAAC
>probe:Drosophila_2:1633994_at:100:123; Interrogation_Position=754; Antisense; AGCGTCAACTCAGCCGGTTGCAAAT

Paste this into a BLAST search page for me
GCAATACTACGGATTTCGCGCGGAGAAGGATGTTCCTTTGTCTACAATAGTAAGTGGCCTATTTCACTCTCCGAAGAAAGAGTTGTGCTTCACTTCACATTGGAAGTTGTGACCACCAAACCGCCAACCGCCAGCGATTACATCGAGTTTGAGTTTTCCAATTTCATGAGCACGGGATACTGCGGAAAGCTTCCCGATTTGATGGACGTTTCTTTCGAGTCACCTTCGAGTCACCTTGCATTCCAATGATTTCCAATGATCGCTTTGTGGCCATCGATCTTCGGGATAATGCCTCCATGCAGAGTTTCGTCTCAACAGCGTCAACAGCGTCAACTCAGCCGGTTGCAAAT

Full Affymetrix probeset data:

Annotations for 1633994_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720