FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633995_at:

>probe:Drosophila_2:1633995_at:123:449; Interrogation_Position=116; Antisense; GATCCAAGAGTTCCGATGCCAGCAG
>probe:Drosophila_2:1633995_at:554:115; Interrogation_Position=145; Antisense; AGCTACGAGCGAACGGTGGACTTTT
>probe:Drosophila_2:1633995_at:696:519; Interrogation_Position=160; Antisense; GTGGACTTTTTCGAGAACATACCGG
>probe:Drosophila_2:1633995_at:287:191; Interrogation_Position=175; Antisense; AACATACCGGATTTCCACGGCGAGT
>probe:Drosophila_2:1633995_at:654:23; Interrogation_Position=308; Antisense; ATAGCGAGAGCACCAGCCAGAGCGA
>probe:Drosophila_2:1633995_at:289:295; Interrogation_Position=345; Antisense; CGACGATGTCCTGCGACTGTGCGAG
>probe:Drosophila_2:1633995_at:98:407; Interrogation_Position=359; Antisense; GACTGTGCGAGGACTTTCTCTGTCG
>probe:Drosophila_2:1633995_at:362:43; Interrogation_Position=386; Antisense; ATCGCATGCGACCTGATTTCTTCTG
>probe:Drosophila_2:1633995_at:60:461; Interrogation_Position=400; Antisense; GATTTCTTCTGCCAATACCACAAGG
>probe:Drosophila_2:1633995_at:148:675; Interrogation_Position=415; Antisense; TACCACAAGGCAGTCAGTTCCACAA
>probe:Drosophila_2:1633995_at:660:649; Interrogation_Position=466; Antisense; TCAACTCCCATTGTGCAGTGCAAGT
>probe:Drosophila_2:1633995_at:705:345; Interrogation_Position=493; Antisense; GCATCCCCGCCAGTAAAAGTGCAAT
>probe:Drosophila_2:1633995_at:532:393; Interrogation_Position=562; Antisense; GAAAGGTTCGCCAAATTCTCAGCCA
>probe:Drosophila_2:1633995_at:253:721; Interrogation_Position=97; Antisense; TTGAAGTCCAAGCTCCAGCGATCCA

Paste this into a BLAST search page for me
GATCCAAGAGTTCCGATGCCAGCAGAGCTACGAGCGAACGGTGGACTTTTGTGGACTTTTTCGAGAACATACCGGAACATACCGGATTTCCACGGCGAGTATAGCGAGAGCACCAGCCAGAGCGACGACGATGTCCTGCGACTGTGCGAGGACTGTGCGAGGACTTTCTCTGTCGATCGCATGCGACCTGATTTCTTCTGGATTTCTTCTGCCAATACCACAAGGTACCACAAGGCAGTCAGTTCCACAATCAACTCCCATTGTGCAGTGCAAGTGCATCCCCGCCAGTAAAAGTGCAATGAAAGGTTCGCCAAATTCTCAGCCATTGAAGTCCAAGCTCCAGCGATCCA

Full Affymetrix probeset data:

Annotations for 1633995_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720