Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634001_at:

>probe:Drosophila_2:1634001_at:287:591; Interrogation_Position=2241; Antisense; TGGTAAATAAGAGAGCCCACGCATT
>probe:Drosophila_2:1634001_at:274:189; Interrogation_Position=2246; Antisense; AATAAGAGAGCCCACGCATTGAACA
>probe:Drosophila_2:1634001_at:211:417; Interrogation_Position=2253; Antisense; GAGCCCACGCATTGAACAACACAAG
>probe:Drosophila_2:1634001_at:386:387; Interrogation_Position=2266; Antisense; GAACAACACAAGAACACCTATCACA
>probe:Drosophila_2:1634001_at:507:381; Interrogation_Position=2277; Antisense; GAACACCTATCACAAACACAACGCA
>probe:Drosophila_2:1634001_at:15:181; Interrogation_Position=2290; Antisense; AAACACAACGCATACTTGATTTCTG
>probe:Drosophila_2:1634001_at:227:345; Interrogation_Position=2299; Antisense; GCATACTTGATTTCTGCAATTGCTA
>probe:Drosophila_2:1634001_at:578:459; Interrogation_Position=2307; Antisense; GATTTCTGCAATTGCTATTGCCTAA
>probe:Drosophila_2:1634001_at:292:7; Interrogation_Position=2317; Antisense; ATTGCTATTGCCTAACCGAGAGTTG
>probe:Drosophila_2:1634001_at:612:5; Interrogation_Position=2323; Antisense; ATTGCCTAACCGAGAGTTGTGCTTA
>probe:Drosophila_2:1634001_at:124:467; Interrogation_Position=2338; Antisense; GTTGTGCTTATATATATCCGCCCCA
>probe:Drosophila_2:1634001_at:198:619; Interrogation_Position=2342; Antisense; TGCTTATATATATCCGCCCCATAGG
>probe:Drosophila_2:1634001_at:12:23; Interrogation_Position=2349; Antisense; ATATATCCGCCCCATAGGTTCGATC
>probe:Drosophila_2:1634001_at:544:683; Interrogation_Position=2352; Antisense; TATCCGCCCCATAGGTTCGATCGGG

Paste this into a BLAST search page for me
TGGTAAATAAGAGAGCCCACGCATTAATAAGAGAGCCCACGCATTGAACAGAGCCCACGCATTGAACAACACAAGGAACAACACAAGAACACCTATCACAGAACACCTATCACAAACACAACGCAAAACACAACGCATACTTGATTTCTGGCATACTTGATTTCTGCAATTGCTAGATTTCTGCAATTGCTATTGCCTAAATTGCTATTGCCTAACCGAGAGTTGATTGCCTAACCGAGAGTTGTGCTTAGTTGTGCTTATATATATCCGCCCCATGCTTATATATATCCGCCCCATAGGATATATCCGCCCCATAGGTTCGATCTATCCGCCCCATAGGTTCGATCGGG

Full Affymetrix probeset data:

Annotations for 1634001_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime