FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634002_at:

>probe:Drosophila_2:1634002_at:628:185; Interrogation_Position=133; Antisense; AACAATATCCCCAAGATGTCTGCCA
>probe:Drosophila_2:1634002_at:148:443; Interrogation_Position=147; Antisense; GATGTCTGCCACTAAGGTGAACCAT
>probe:Drosophila_2:1634002_at:226:509; Interrogation_Position=163; Antisense; GTGAACCATTTGATCGGAGCGACTA
>probe:Drosophila_2:1634002_at:81:673; Interrogation_Position=186; Antisense; TACGCGCTACATTGCCGGACGGAAT
>probe:Drosophila_2:1634002_at:607:233; Interrogation_Position=208; Antisense; AATGCGGTGCAGACGGTCTACTGGC
>probe:Drosophila_2:1634002_at:691:617; Interrogation_Position=278; Antisense; TGCAGAACTTCGATCGCACCCAGAA
>probe:Drosophila_2:1634002_at:711:321; Interrogation_Position=304; Antisense; GCGCCTCAGAGTGTACGGATGCAGA
>probe:Drosophila_2:1634002_at:626:681; Interrogation_Position=331; Antisense; TATGATCGCAGCTATATCCGTGATT
>probe:Drosophila_2:1634002_at:68:691; Interrogation_Position=361; Antisense; TTAGTTTTAGTTCCGGCCTTGACAT
>probe:Drosophila_2:1634002_at:209:631; Interrogation_Position=372; Antisense; TCCGGCCTTGACATGTTCCTAATGT
>probe:Drosophila_2:1634002_at:168:379; Interrogation_Position=511; Antisense; GAAGCTGGCGCTACGACTTTTCATG
>probe:Drosophila_2:1634002_at:146:297; Interrogation_Position=524; Antisense; CGACTTTTCATGTACCTTGGCATTA
>probe:Drosophila_2:1634002_at:500:423; Interrogation_Position=76; Antisense; GAGACGACTCTATAGCGAAAGCAAC
>probe:Drosophila_2:1634002_at:650:323; Interrogation_Position=90; Antisense; GCGAAAGCAACCCAACTGTGATACT

Paste this into a BLAST search page for me
AACAATATCCCCAAGATGTCTGCCAGATGTCTGCCACTAAGGTGAACCATGTGAACCATTTGATCGGAGCGACTATACGCGCTACATTGCCGGACGGAATAATGCGGTGCAGACGGTCTACTGGCTGCAGAACTTCGATCGCACCCAGAAGCGCCTCAGAGTGTACGGATGCAGATATGATCGCAGCTATATCCGTGATTTTAGTTTTAGTTCCGGCCTTGACATTCCGGCCTTGACATGTTCCTAATGTGAAGCTGGCGCTACGACTTTTCATGCGACTTTTCATGTACCTTGGCATTAGAGACGACTCTATAGCGAAAGCAACGCGAAAGCAACCCAACTGTGATACT

Full Affymetrix probeset data:

Annotations for 1634002_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720