Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634003_at:

>probe:Drosophila_2:1634003_at:295:117; Interrogation_Position=5354; Antisense; AGCTCGCTCCTCGAAAACGTTGTCG
>probe:Drosophila_2:1634003_at:262:275; Interrogation_Position=5508; Antisense; CTTCCAACTATTGCGGCTTCCTGAA
>probe:Drosophila_2:1634003_at:131:527; Interrogation_Position=5541; Antisense; GGGAACGCGATACCACCGAGGATAA
>probe:Drosophila_2:1634003_at:587:303; Interrogation_Position=5556; Antisense; CCGAGGATAATCTAGCCCGCTTGGA
>probe:Drosophila_2:1634003_at:394:589; Interrogation_Position=5577; Antisense; TGGATGGCACCAAGCGTCTGATGCA
>probe:Drosophila_2:1634003_at:549:499; Interrogation_Position=5592; Antisense; GTCTGATGCAGAACCGCAGGACCAC
>probe:Drosophila_2:1634003_at:300:269; Interrogation_Position=5620; Antisense; CATGGCGGACTATCTCCAGCTGGAG
>probe:Drosophila_2:1634003_at:353:435; Interrogation_Position=5642; Antisense; GAGGATTGGAAACCACCCACAACTT
>probe:Drosophila_2:1634003_at:400:387; Interrogation_Position=5725; Antisense; GAAAATGCGAGCCATCGGTTTTGTG
>probe:Drosophila_2:1634003_at:304:537; Interrogation_Position=5753; Antisense; GGTCAAACCGACTGGAACCGCATGA
>probe:Drosophila_2:1634003_at:178:369; Interrogation_Position=5785; Antisense; GAATGCCGGCAGTCGGGCTTTGAAT
>probe:Drosophila_2:1634003_at:454:181; Interrogation_Position=5810; Antisense; AAAACCAAGTTTATCGAGCGCATCA
>probe:Drosophila_2:1634003_at:445:251; Interrogation_Position=5833; Antisense; CAAGCGTCGCTAGATGTCAATTACA
>probe:Drosophila_2:1634003_at:470:179; Interrogation_Position=5901; Antisense; AACAAAAACTCGCAGCATTTCCACT

Paste this into a BLAST search page for me
AGCTCGCTCCTCGAAAACGTTGTCGCTTCCAACTATTGCGGCTTCCTGAAGGGAACGCGATACCACCGAGGATAACCGAGGATAATCTAGCCCGCTTGGATGGATGGCACCAAGCGTCTGATGCAGTCTGATGCAGAACCGCAGGACCACCATGGCGGACTATCTCCAGCTGGAGGAGGATTGGAAACCACCCACAACTTGAAAATGCGAGCCATCGGTTTTGTGGGTCAAACCGACTGGAACCGCATGAGAATGCCGGCAGTCGGGCTTTGAATAAAACCAAGTTTATCGAGCGCATCACAAGCGTCGCTAGATGTCAATTACAAACAAAAACTCGCAGCATTTCCACT

Full Affymetrix probeset data:

Annotations for 1634003_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime