FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634004_at:

>probe:Drosophila_2:1634004_at:160:247; Interrogation_Position=105; Antisense; AATTGAAGCGAATTCCCAAGCACTT
>probe:Drosophila_2:1634004_at:630:209; Interrogation_Position=122; Antisense; AAGCACTTCCCACGGATACGGAGAA
>probe:Drosophila_2:1634004_at:702:471; Interrogation_Position=18; Antisense; GTTCATCTATTTGACGCTGGCATTG
>probe:Drosophila_2:1634004_at:176:147; Interrogation_Position=180; Antisense; ACTAATACTCAGAAGGGCGCCCAAT
>probe:Drosophila_2:1634004_at:646:523; Interrogation_Position=194; Antisense; GGGCGCCCAATCAGAGTGGCAGTAA
>probe:Drosophila_2:1634004_at:31:521; Interrogation_Position=209; Antisense; GTGGCAGTAACCTACAGGACCTGGT
>probe:Drosophila_2:1634004_at:80:427; Interrogation_Position=240; Antisense; GAGAGGAGTTCTTCAGGCTCTGAAA
>probe:Drosophila_2:1634004_at:419:571; Interrogation_Position=255; Antisense; GGCTCTGAAAGCGAGTCCCTCGAAA
>probe:Drosophila_2:1634004_at:518:211; Interrogation_Position=343; Antisense; AAGTTTCCGCCCATACTGGAGAATA
>probe:Drosophila_2:1634004_at:447:133; Interrogation_Position=423; Antisense; ACCCGGTGGATTGCAGCGAATTGAA
>probe:Drosophila_2:1634004_at:640:361; Interrogation_Position=440; Antisense; GAATTGAACTTACTACACAGCCGCC
>probe:Drosophila_2:1634004_at:529:443; Interrogation_Position=466; Antisense; GATGATTCTCCGGATGTAACCACTG
>probe:Drosophila_2:1634004_at:506:639; Interrogation_Position=524; Antisense; TCGGTGAGCAGGACGCGTACATTAC
>probe:Drosophila_2:1634004_at:46:273; Interrogation_Position=75; Antisense; CATTATACCACTGACCCTGATCAAA

Paste this into a BLAST search page for me
AATTGAAGCGAATTCCCAAGCACTTAAGCACTTCCCACGGATACGGAGAAGTTCATCTATTTGACGCTGGCATTGACTAATACTCAGAAGGGCGCCCAATGGGCGCCCAATCAGAGTGGCAGTAAGTGGCAGTAACCTACAGGACCTGGTGAGAGGAGTTCTTCAGGCTCTGAAAGGCTCTGAAAGCGAGTCCCTCGAAAAAGTTTCCGCCCATACTGGAGAATAACCCGGTGGATTGCAGCGAATTGAAGAATTGAACTTACTACACAGCCGCCGATGATTCTCCGGATGTAACCACTGTCGGTGAGCAGGACGCGTACATTACCATTATACCACTGACCCTGATCAAA

Full Affymetrix probeset data:

Annotations for 1634004_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720