FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634005_at:

>probe:Drosophila_2:1634005_at:326:695; Interrogation_Position=1002; Antisense; TTTCCAGGCCAATGTGAGCTGAGTC
>probe:Drosophila_2:1634005_at:580:495; Interrogation_Position=1024; Antisense; GTCAGTGGAACTGCTTCAACACCAA
>probe:Drosophila_2:1634005_at:5:371; Interrogation_Position=1049; Antisense; GAATGTTTTCCACCAAGTGCACGAT
>probe:Drosophila_2:1634005_at:636:509; Interrogation_Position=1065; Antisense; GTGCACGATGCCGAATGCCAAAATA
>probe:Drosophila_2:1634005_at:544:57; Interrogation_Position=1113; Antisense; ATGATGTAAGCTGTTCCTCTGGGAT
>probe:Drosophila_2:1634005_at:119:471; Interrogation_Position=1125; Antisense; GTTCCTCTGGGATGTGATTCAATTA
>probe:Drosophila_2:1634005_at:506:549; Interrogation_Position=776; Antisense; GGAGGATCCTGAACCATCCGAAACA
>probe:Drosophila_2:1634005_at:443:217; Interrogation_Position=812; Antisense; AAGTTCATCGAAGGCTGGTCGCTCG
>probe:Drosophila_2:1634005_at:157:337; Interrogation_Position=832; Antisense; GCTCGCTGGTTATTCCCGATAAAGT
>probe:Drosophila_2:1634005_at:507:21; Interrogation_Position=862; Antisense; ATATAGTCAACCAAGTTCACGCCCA
>probe:Drosophila_2:1634005_at:676:193; Interrogation_Position=895; Antisense; AACTGATTGCCCAGCATCGTGAGGA
>probe:Drosophila_2:1634005_at:685:361; Interrogation_Position=937; Antisense; GCAATTTTCAGTGTCCCAAAGCATC
>probe:Drosophila_2:1634005_at:12:209; Interrogation_Position=955; Antisense; AAGCATCACTGTCCATTTGTGCCAG
>probe:Drosophila_2:1634005_at:177:169; Interrogation_Position=987; Antisense; AAATGTGTGGTCAATTTTCCAGGCC

Paste this into a BLAST search page for me
TTTCCAGGCCAATGTGAGCTGAGTCGTCAGTGGAACTGCTTCAACACCAAGAATGTTTTCCACCAAGTGCACGATGTGCACGATGCCGAATGCCAAAATAATGATGTAAGCTGTTCCTCTGGGATGTTCCTCTGGGATGTGATTCAATTAGGAGGATCCTGAACCATCCGAAACAAAGTTCATCGAAGGCTGGTCGCTCGGCTCGCTGGTTATTCCCGATAAAGTATATAGTCAACCAAGTTCACGCCCAAACTGATTGCCCAGCATCGTGAGGAGCAATTTTCAGTGTCCCAAAGCATCAAGCATCACTGTCCATTTGTGCCAGAAATGTGTGGTCAATTTTCCAGGCC

Full Affymetrix probeset data:

Annotations for 1634005_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720