FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634008_at:

>probe:Drosophila_2:1634008_at:533:33; Interrogation_Position=112; Antisense; ATCAGGATGCAAAAGCGTTTAAGCT
>probe:Drosophila_2:1634008_at:113:209; Interrogation_Position=132; Antisense; AAGCTATCATATTCTGCTCGGTCCG
>probe:Drosophila_2:1634008_at:114:389; Interrogation_Position=203; Antisense; GAAAAAACGGAAGTCTCTACTGCTT
>probe:Drosophila_2:1634008_at:677:87; Interrogation_Position=214; Antisense; AGTCTCTACTGCTTCTATGATACCA
>probe:Drosophila_2:1634008_at:457:711; Interrogation_Position=22; Antisense; TTAATTTTTAATCGCTCCTCAGAAA
>probe:Drosophila_2:1634008_at:495:211; Interrogation_Position=243; Antisense; AAGAACTTTCTATTCTCTGCTCGCA
>probe:Drosophila_2:1634008_at:659:619; Interrogation_Position=260; Antisense; TGCTCGCACCAATCAAAGCAGAAGT
>probe:Drosophila_2:1634008_at:234:373; Interrogation_Position=280; Antisense; GAAGTGCTCTTTATTGATCCATTGG
>probe:Drosophila_2:1634008_at:313:401; Interrogation_Position=295; Antisense; GATCCATTGGTTATACTTTACCACG
>probe:Drosophila_2:1634008_at:354:387; Interrogation_Position=43; Antisense; GAAAATTGGACTCTGGCGCTTGAAA
>probe:Drosophila_2:1634008_at:101:553; Interrogation_Position=50; Antisense; GGACTCTGGCGCTTGAAACTGTTGA
>probe:Drosophila_2:1634008_at:60:179; Interrogation_Position=65; Antisense; AAACTGTTGAGTTTGCTCTGAAGTC
>probe:Drosophila_2:1634008_at:97:337; Interrogation_Position=79; Antisense; GCTCTGAAGTCAAATCCACGCAATG
>probe:Drosophila_2:1634008_at:30:629; Interrogation_Position=93; Antisense; TCCACGCAATGCACAGTTGATCAGG

Paste this into a BLAST search page for me
ATCAGGATGCAAAAGCGTTTAAGCTAAGCTATCATATTCTGCTCGGTCCGGAAAAAACGGAAGTCTCTACTGCTTAGTCTCTACTGCTTCTATGATACCATTAATTTTTAATCGCTCCTCAGAAAAAGAACTTTCTATTCTCTGCTCGCATGCTCGCACCAATCAAAGCAGAAGTGAAGTGCTCTTTATTGATCCATTGGGATCCATTGGTTATACTTTACCACGGAAAATTGGACTCTGGCGCTTGAAAGGACTCTGGCGCTTGAAACTGTTGAAAACTGTTGAGTTTGCTCTGAAGTCGCTCTGAAGTCAAATCCACGCAATGTCCACGCAATGCACAGTTGATCAGG

Full Affymetrix probeset data:

Annotations for 1634008_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720