Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634009_at:

>probe:Drosophila_2:1634009_at:78:241; Interrogation_Position=3304; Antisense; AATAATGCTGCCATCGGATTTCACC
>probe:Drosophila_2:1634009_at:199:653; Interrogation_Position=3331; Antisense; TCAAGCGCCAACAACTTCGTTGCAG
>probe:Drosophila_2:1634009_at:655:467; Interrogation_Position=3349; Antisense; GTTGCAGACCACCATTGCCAATAAC
>probe:Drosophila_2:1634009_at:142:241; Interrogation_Position=3374; Antisense; AATAGCGAAAACACCCTGCCATCAT
>probe:Drosophila_2:1634009_at:273:3; Interrogation_Position=3406; Antisense; ATTGGACTGGCCGACGATGCAAAAA
>probe:Drosophila_2:1634009_at:504:49; Interrogation_Position=3444; Antisense; ATGCGCGGCATCATTAAGCCCAGGA
>probe:Drosophila_2:1634009_at:293:385; Interrogation_Position=3494; Antisense; GAACTTAACTGAATGCCCTAACTTT
>probe:Drosophila_2:1634009_at:339:379; Interrogation_Position=3523; Antisense; GAAGCCATATCGAAGACACTCTGCA
>probe:Drosophila_2:1634009_at:327:101; Interrogation_Position=3589; Antisense; AGAGTTAATCACCTGTACCATTTCC
>probe:Drosophila_2:1634009_at:707:487; Interrogation_Position=3603; Antisense; GTACCATTTCCCCTCATTATTAGAT
>probe:Drosophila_2:1634009_at:361:491; Interrogation_Position=3639; Antisense; GTAACCTATTTTAAGCGTTCGCGCA
>probe:Drosophila_2:1634009_at:89:483; Interrogation_Position=3707; Antisense; GTATTTACCGCCCAAATGTAGCCAT
>probe:Drosophila_2:1634009_at:403:233; Interrogation_Position=3738; Antisense; AATGCTAATCCATGTCCCAGTATTT
>probe:Drosophila_2:1634009_at:353:541; Interrogation_Position=3768; Antisense; GGTTCGACTGACTATTGGCTGACAA

Paste this into a BLAST search page for me
AATAATGCTGCCATCGGATTTCACCTCAAGCGCCAACAACTTCGTTGCAGGTTGCAGACCACCATTGCCAATAACAATAGCGAAAACACCCTGCCATCATATTGGACTGGCCGACGATGCAAAAAATGCGCGGCATCATTAAGCCCAGGAGAACTTAACTGAATGCCCTAACTTTGAAGCCATATCGAAGACACTCTGCAAGAGTTAATCACCTGTACCATTTCCGTACCATTTCCCCTCATTATTAGATGTAACCTATTTTAAGCGTTCGCGCAGTATTTACCGCCCAAATGTAGCCATAATGCTAATCCATGTCCCAGTATTTGGTTCGACTGACTATTGGCTGACAA

Full Affymetrix probeset data:

Annotations for 1634009_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime