FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634011_at:

>probe:Drosophila_2:1634011_at:676:79; Interrogation_Position=431; Antisense; AGGTCTCGCACATATTCTCTACGGT
>probe:Drosophila_2:1634011_at:95:571; Interrogation_Position=460; Antisense; GGCTTGGATCTCAAATTCGGCACCC
>probe:Drosophila_2:1634011_at:463:639; Interrogation_Position=476; Antisense; TCGGCACCCACCTGATGAAGCAATT
>probe:Drosophila_2:1634011_at:637:727; Interrogation_Position=499; Antisense; TTGGGTCACCAGCTCAAGGACATGA
>probe:Drosophila_2:1634011_at:609:379; Interrogation_Position=556; Antisense; GAACCAGTTAATCTAGCCGACCAAA
>probe:Drosophila_2:1634011_at:434:177; Interrogation_Position=580; Antisense; AAACGTTCAAAGTCTCCGCGAGAAG
>probe:Drosophila_2:1634011_at:188:373; Interrogation_Position=644; Antisense; GAAGGGCATTCCATATATACGCAAC
>probe:Drosophila_2:1634011_at:631:457; Interrogation_Position=680; Antisense; GATAGCTTTACTACTCAGTTTCATT
>probe:Drosophila_2:1634011_at:552:161; Interrogation_Position=710; Antisense; ACAATCCAAGTTTTCCAAGGTCTAG
>probe:Drosophila_2:1634011_at:162:537; Interrogation_Position=728; Antisense; GGTCTAGTGTAAACATTTGCCTCAG
>probe:Drosophila_2:1634011_at:641:511; Interrogation_Position=787; Antisense; GTGATGTTCCTGTGATAGTTCTTAA
>probe:Drosophila_2:1634011_at:293:689; Interrogation_Position=824; Antisense; TATTTGATCTCCCATAGGCTTACTG
>probe:Drosophila_2:1634011_at:503:645; Interrogation_Position=879; Antisense; TCATCAACTTTGCAAGAGCTTCCCC
>probe:Drosophila_2:1634011_at:463:419; Interrogation_Position=907; Antisense; GAGCTTCCACTTAGCCTCATTAAGA

Paste this into a BLAST search page for me
AGGTCTCGCACATATTCTCTACGGTGGCTTGGATCTCAAATTCGGCACCCTCGGCACCCACCTGATGAAGCAATTTTGGGTCACCAGCTCAAGGACATGAGAACCAGTTAATCTAGCCGACCAAAAAACGTTCAAAGTCTCCGCGAGAAGGAAGGGCATTCCATATATACGCAACGATAGCTTTACTACTCAGTTTCATTACAATCCAAGTTTTCCAAGGTCTAGGGTCTAGTGTAAACATTTGCCTCAGGTGATGTTCCTGTGATAGTTCTTAATATTTGATCTCCCATAGGCTTACTGTCATCAACTTTGCAAGAGCTTCCCCGAGCTTCCACTTAGCCTCATTAAGA

Full Affymetrix probeset data:

Annotations for 1634011_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720