Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634012_at:

>probe:Drosophila_2:1634012_at:254:109; Interrogation_Position=1414; Antisense; AGAAGGATCTGTTTCCCTTTGTGGT
>probe:Drosophila_2:1634012_at:367:729; Interrogation_Position=1432; Antisense; TTGTGGTCACTGTACTCACCTGCAT
>probe:Drosophila_2:1634012_at:304:651; Interrogation_Position=1447; Antisense; TCACCTGCATGTTCTGGAGTCTGGA
>probe:Drosophila_2:1634012_at:340:141; Interrogation_Position=1474; Antisense; ACGGAATACTGTGTGGCATCGGTGC
>probe:Drosophila_2:1634012_at:672:345; Interrogation_Position=1489; Antisense; GCATCGGTGCCAACATGGTATACAT
>probe:Drosophila_2:1634012_at:40:115; Interrogation_Position=1521; Antisense; AGCAGTGCACGTCCACATGTAGACA
>probe:Drosophila_2:1634012_at:173:121; Interrogation_Position=1600; Antisense; AGCTGGACTATGCATCGGCTGAGTA
>probe:Drosophila_2:1634012_at:391:371; Interrogation_Position=1634; Antisense; GAAGGTGGTGCGCTTCCTGAACAAC
>probe:Drosophila_2:1634012_at:146:575; Interrogation_Position=1665; Antisense; GGCGAGACCCAGTTGGTGGTTATCA
>probe:Drosophila_2:1634012_at:448:19; Interrogation_Position=1753; Antisense; ATTTGGAGGCACTGAACTGCGCCAT
>probe:Drosophila_2:1634012_at:695:193; Interrogation_Position=1767; Antisense; AACTGCGCCATGATCTGCTGGAACT
>probe:Drosophila_2:1634012_at:233:305; Interrogation_Position=1838; Antisense; CCGTCCCATCTTCAAGTTCGATTTA
>probe:Drosophila_2:1634012_at:430:589; Interrogation_Position=1876; Antisense; TGGTAGCTGGCCACTTCGATAGTCC
>probe:Drosophila_2:1634012_at:546:131; Interrogation_Position=1917; Antisense; ACCGTAACCATCGAGGCCTGAAGAA

Paste this into a BLAST search page for me
AGAAGGATCTGTTTCCCTTTGTGGTTTGTGGTCACTGTACTCACCTGCATTCACCTGCATGTTCTGGAGTCTGGAACGGAATACTGTGTGGCATCGGTGCGCATCGGTGCCAACATGGTATACATAGCAGTGCACGTCCACATGTAGACAAGCTGGACTATGCATCGGCTGAGTAGAAGGTGGTGCGCTTCCTGAACAACGGCGAGACCCAGTTGGTGGTTATCAATTTGGAGGCACTGAACTGCGCCATAACTGCGCCATGATCTGCTGGAACTCCGTCCCATCTTCAAGTTCGATTTATGGTAGCTGGCCACTTCGATAGTCCACCGTAACCATCGAGGCCTGAAGAA

Full Affymetrix probeset data:

Annotations for 1634012_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime