FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634013_at:

>probe:Drosophila_2:1634013_at:467:221; Interrogation_Position=174; Antisense; AAGGTCGGCTGCTGAAGCTGCGTAA
>probe:Drosophila_2:1634013_at:654:211; Interrogation_Position=197; Antisense; AAGACCGTCACTGCGTTGGTGAAGC
>probe:Drosophila_2:1634013_at:573:111; Interrogation_Position=219; Antisense; AGCACGAGCGTATTGAACTGTTCTA
>probe:Drosophila_2:1634013_at:198:603; Interrogation_Position=237; Antisense; TGTTCTACAACCGTGCCGATGAAGC
>probe:Drosophila_2:1634013_at:610:383; Interrogation_Position=275; Antisense; GAACTGCTCATTTCCAATGCCATAC
>probe:Drosophila_2:1634013_at:24:361; Interrogation_Position=358; Antisense; GCAACTGGTTCATAAGCTCTTCAAG
>probe:Drosophila_2:1634013_at:432:537; Interrogation_Position=388; Antisense; GGTACCGCGCTATGAGACTTACAAT
>probe:Drosophila_2:1634013_at:592:595; Interrogation_Position=412; Antisense; TGTGTCCTACACTCGCATGTACAAA
>probe:Drosophila_2:1634013_at:420:505; Interrogation_Position=442; Antisense; TCGGGAGTATCCTGGCATTTACTAC
>probe:Drosophila_2:1634013_at:603:329; Interrogation_Position=512; Antisense; GCGGCGGATCATTCTCAGAACCGGA
>probe:Drosophila_2:1634013_at:94:109; Interrogation_Position=528; Antisense; AGAACCGGAATCTGCTGCACAATGT
>probe:Drosophila_2:1634013_at:150:257; Interrogation_Position=545; Antisense; CACAATGTGCTTCTGGACGAGGCGA
>probe:Drosophila_2:1634013_at:213:655; Interrogation_Position=611; Antisense; TAATAGCTCTTTTCACTAACCGCCT
>probe:Drosophila_2:1634013_at:679:349; Interrogation_Position=657; Antisense; GCAGTTTGTCGCTTAGAATTCACGT

Paste this into a BLAST search page for me
AAGGTCGGCTGCTGAAGCTGCGTAAAAGACCGTCACTGCGTTGGTGAAGCAGCACGAGCGTATTGAACTGTTCTATGTTCTACAACCGTGCCGATGAAGCGAACTGCTCATTTCCAATGCCATACGCAACTGGTTCATAAGCTCTTCAAGGGTACCGCGCTATGAGACTTACAATTGTGTCCTACACTCGCATGTACAAATCGGGAGTATCCTGGCATTTACTACGCGGCGGATCATTCTCAGAACCGGAAGAACCGGAATCTGCTGCACAATGTCACAATGTGCTTCTGGACGAGGCGATAATAGCTCTTTTCACTAACCGCCTGCAGTTTGTCGCTTAGAATTCACGT

Full Affymetrix probeset data:

Annotations for 1634013_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720