FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634014_at:

>probe:Drosophila_2:1634014_at:496:129; Interrogation_Position=1915; Antisense; ACCTTTGAGTCGATGATGGCCTGCC
>probe:Drosophila_2:1634014_at:177:67; Interrogation_Position=1930; Antisense; ATGGCCTGCCGGGATTGGTTTTACA
>probe:Drosophila_2:1634014_at:85:387; Interrogation_Position=1958; Antisense; GAACACGTGCAAATCGACAGCCAAA
>probe:Drosophila_2:1634014_at:383:223; Interrogation_Position=1999; Antisense; AAGGTCAACGAGTTCAATGCCAAGG
>probe:Drosophila_2:1634014_at:635:223; Interrogation_Position=2020; Antisense; AAGGATCTTCTGACTATTATACGCA
>probe:Drosophila_2:1634014_at:21:493; Interrogation_Position=2045; Antisense; GTAATTTGCGCTTCGAAGAGGCCTG
>probe:Drosophila_2:1634014_at:278:373; Interrogation_Position=2059; Antisense; GAAGAGGCCTGTTTTGTGCCCAATC
>probe:Drosophila_2:1634014_at:110:249; Interrogation_Position=2079; Antisense; CAATCCCAACTACTTCGAGGGCGAA
>probe:Drosophila_2:1634014_at:111:81; Interrogation_Position=2215; Antisense; AGGGACAACTCGCAACTTTCCATAT
>probe:Drosophila_2:1634014_at:549:33; Interrogation_Position=2242; Antisense; ATCAATGCCTTCTTCGAGTACCTGA
>probe:Drosophila_2:1634014_at:462:367; Interrogation_Position=2301; Antisense; GAACGAACTGGATGTCCTGGTCACC
>probe:Drosophila_2:1634014_at:111:615; Interrogation_Position=2372; Antisense; TGAAGTCATCGAATCCTTGGCAATG
>probe:Drosophila_2:1634014_at:261:689; Interrogation_Position=2429; Antisense; TATTCGCCTTAAATTTCGTCGTGGT
>probe:Drosophila_2:1634014_at:642:635; Interrogation_Position=2447; Antisense; TCGTGGTTTACGTTTACTTGTCTCT

Paste this into a BLAST search page for me
ACCTTTGAGTCGATGATGGCCTGCCATGGCCTGCCGGGATTGGTTTTACAGAACACGTGCAAATCGACAGCCAAAAAGGTCAACGAGTTCAATGCCAAGGAAGGATCTTCTGACTATTATACGCAGTAATTTGCGCTTCGAAGAGGCCTGGAAGAGGCCTGTTTTGTGCCCAATCCAATCCCAACTACTTCGAGGGCGAAAGGGACAACTCGCAACTTTCCATATATCAATGCCTTCTTCGAGTACCTGAGAACGAACTGGATGTCCTGGTCACCTGAAGTCATCGAATCCTTGGCAATGTATTCGCCTTAAATTTCGTCGTGGTTCGTGGTTTACGTTTACTTGTCTCT

Full Affymetrix probeset data:

Annotations for 1634014_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720