Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634016_at:

>probe:Drosophila_2:1634016_at:297:515; Interrogation_Position=1398; Antisense; GTGTGCTCGTGAACGCCGGCAACAA
>probe:Drosophila_2:1634016_at:390:529; Interrogation_Position=1533; Antisense; GGGAGTCCAAGCCTACATCTAAGCC
>probe:Drosophila_2:1634016_at:297:559; Interrogation_Position=1614; Antisense; GGACAATCCATGGTGATCGCACGTA
>probe:Drosophila_2:1634016_at:420:453; Interrogation_Position=1641; Antisense; GATCACAAATCGCTGGCATACCGCT
>probe:Drosophila_2:1634016_at:501:505; Interrogation_Position=1666; Antisense; GTCCATCGATCATTTCTTAGCTACA
>probe:Drosophila_2:1634016_at:626:243; Interrogation_Position=1691; Antisense; AATATATCCACATTTAGTCCCCAAC
>probe:Drosophila_2:1634016_at:313:347; Interrogation_Position=1723; Antisense; GCATCCAGTCATCCATGTTCATGTA
>probe:Drosophila_2:1634016_at:600:151; Interrogation_Position=1747; Antisense; ACATAGATCGTATATAGCTGCTGCT
>probe:Drosophila_2:1634016_at:248:339; Interrogation_Position=1769; Antisense; GCTAATTTAGTGGTACGGCGTTCAT
>probe:Drosophila_2:1634016_at:24:489; Interrogation_Position=1781; Antisense; GTACGGCGTTCATCTACTTTTAATG
>probe:Drosophila_2:1634016_at:189:655; Interrogation_Position=1801; Antisense; TAATGCTTAAGTACACCCTTTCGGG
>probe:Drosophila_2:1634016_at:335:551; Interrogation_Position=1825; Antisense; GGACGTGTATTTCCGCTTTTCGTAT
>probe:Drosophila_2:1634016_at:11:277; Interrogation_Position=1840; Antisense; CTTTTCGTATCTATCGCTCAACAAT
>probe:Drosophila_2:1634016_at:283:701; Interrogation_Position=1872; Antisense; TTTTCTTTATGCAAGCGACGCTTTT

Paste this into a BLAST search page for me
GTGTGCTCGTGAACGCCGGCAACAAGGGAGTCCAAGCCTACATCTAAGCCGGACAATCCATGGTGATCGCACGTAGATCACAAATCGCTGGCATACCGCTGTCCATCGATCATTTCTTAGCTACAAATATATCCACATTTAGTCCCCAACGCATCCAGTCATCCATGTTCATGTAACATAGATCGTATATAGCTGCTGCTGCTAATTTAGTGGTACGGCGTTCATGTACGGCGTTCATCTACTTTTAATGTAATGCTTAAGTACACCCTTTCGGGGGACGTGTATTTCCGCTTTTCGTATCTTTTCGTATCTATCGCTCAACAATTTTTCTTTATGCAAGCGACGCTTTT

Full Affymetrix probeset data:

Annotations for 1634016_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime