FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634017_at:

>probe:Drosophila_2:1634017_at:326:601; Interrogation_Position=1890; Antisense; TGTATACGTTGAACATGCCCACCAT
>probe:Drosophila_2:1634017_at:98:317; Interrogation_Position=1953; Antisense; GCCGGGTAGCTATTGGAAGCGCTCA
>probe:Drosophila_2:1634017_at:509:729; Interrogation_Position=1965; Antisense; TTGGAAGCGCTCACTGCAAACGGAT
>probe:Drosophila_2:1634017_at:565:163; Interrogation_Position=1982; Antisense; AAACGGATCCCTCAGTCGAGGACAC
>probe:Drosophila_2:1634017_at:708:73; Interrogation_Position=2000; Antisense; AGGACACAGACTCCTCCACGGACAG
>probe:Drosophila_2:1634017_at:51:155; Interrogation_Position=2055; Antisense; ACAGATCCAGGATCCCCATTACCTG
>probe:Drosophila_2:1634017_at:361:13; Interrogation_Position=2072; Antisense; ATTACCTGGCCTATCGCAACCAGTA
>probe:Drosophila_2:1634017_at:313:297; Interrogation_Position=2086; Antisense; CGCAACCAGTATGGCCAGTGGCAGT
>probe:Drosophila_2:1634017_at:723:283; Interrogation_Position=2141; Antisense; CTGAACTCTGACCTCCAATGGAGAC
>probe:Drosophila_2:1634017_at:148:19; Interrogation_Position=2182; Antisense; ATTTGATTAACATTCGTGGTACGAC
>probe:Drosophila_2:1634017_at:642:517; Interrogation_Position=2197; Antisense; GTGGTACGACGCTGATTATTAAATA
>probe:Drosophila_2:1634017_at:165:659; Interrogation_Position=2215; Antisense; TTAAATAATCCATAAGGCCCTAGAG
>probe:Drosophila_2:1634017_at:143:511; Interrogation_Position=2310; Antisense; GTGCAATGCCTTAAATATATGACTA
>probe:Drosophila_2:1634017_at:225:479; Interrogation_Position=2374; Antisense; GTTTCGGATACATACGCAGCGAGCA

Paste this into a BLAST search page for me
TGTATACGTTGAACATGCCCACCATGCCGGGTAGCTATTGGAAGCGCTCATTGGAAGCGCTCACTGCAAACGGATAAACGGATCCCTCAGTCGAGGACACAGGACACAGACTCCTCCACGGACAGACAGATCCAGGATCCCCATTACCTGATTACCTGGCCTATCGCAACCAGTACGCAACCAGTATGGCCAGTGGCAGTCTGAACTCTGACCTCCAATGGAGACATTTGATTAACATTCGTGGTACGACGTGGTACGACGCTGATTATTAAATATTAAATAATCCATAAGGCCCTAGAGGTGCAATGCCTTAAATATATGACTAGTTTCGGATACATACGCAGCGAGCA

Full Affymetrix probeset data:

Annotations for 1634017_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720